Incidental Mutation 'R7165:Asb3'
ID557884
Institutional Source Beutler Lab
Gene Symbol Asb3
Ensembl Gene ENSMUSG00000020305
Gene Nameankyrin repeat and SOCS box-containing 3
Synonyms2400011J03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R7165 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location30885416-31102704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31029029 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 106 (N106K)
Ref Sequence ENSEMBL: ENSMUSP00000020551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020551] [ENSMUST00000117883] [ENSMUST00000137306] [ENSMUST00000203878]
Predicted Effect probably damaging
Transcript: ENSMUST00000020551
AA Change: N106K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020551
Gene: ENSMUSG00000020305
AA Change: N106K

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 1.23e0 SMART
ANK 78 107 7.3e-3 SMART
ANK 111 140 2.66e-5 SMART
ANK 145 174 2.73e-2 SMART
ANK 178 207 2.81e-4 SMART
ANK 211 240 1.88e-5 SMART
ANK 246 276 1.6e2 SMART
ANK 279 308 1.9e-1 SMART
ANK 315 346 1.17e2 SMART
SOCS_box 460 502 2.1e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117883
AA Change: N106K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113072
Gene: ENSMUSG00000020305
AA Change: N106K

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 1.23e0 SMART
ANK 78 107 7.3e-3 SMART
ANK 111 140 2.66e-5 SMART
ANK 145 174 2.73e-2 SMART
ANK 178 207 2.81e-4 SMART
ANK 211 240 1.88e-5 SMART
ANK 246 276 1.6e2 SMART
ANK 279 308 1.9e-1 SMART
ANK 315 346 1.17e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137306
SMART Domains Protein: ENSMUSP00000114692
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 4.3e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203878
AA Change: N145K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144900
Gene: ENSMUSG00000020305
AA Change: N145K

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
ANK 48 77 3.5e-2 SMART
ANK 81 110 8e-3 SMART
ANK 117 146 4.8e-5 SMART
ANK 150 179 1.7e-7 SMART
ANK 184 213 1.8e-4 SMART
ANK 217 246 1.8e-6 SMART
ANK 250 279 1.2e-7 SMART
ANK 285 315 1.1e0 SMART
ANK 318 347 1.2e-3 SMART
ANK 354 385 7.7e-1 SMART
SOCS 493 542 2.8e-4 SMART
SOCS_box 499 541 1.6e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl C A 2: 128,123,108 A624E probably benign Het
Adnp A G 2: 168,182,367 S1003P probably benign Het
Akap8l T C 17: 32,338,412 D75G probably damaging Het
Ap4e1 A T 2: 127,063,318 T970S possibly damaging Het
Atp1a3 T C 7: 24,978,965 I988V probably benign Het
Camta1 A G 4: 151,084,700 L198S possibly damaging Het
Ccdc77 A G 6: 120,350,232 L84P probably damaging Het
Ccne1 C T 7: 38,099,301 A298T probably damaging Het
Cdc42bpb T A 12: 111,321,517 E532V probably damaging Het
Clasp2 G A 9: 113,786,399 probably null Het
Cntnap5b C A 1: 100,076,162 T289N possibly damaging Het
Dcun1d4 A G 5: 73,491,195 probably null Het
Dnah14 A G 1: 181,704,535 T2296A probably benign Het
Dnaja4 A T 9: 54,709,232 Q173L probably damaging Het
Dync2h1 G A 9: 7,050,479 A3190V probably benign Het
Frrs1 T A 3: 116,878,271 I6N probably benign Het
Fscn1 T C 5: 142,972,046 V477A probably benign Het
Fsip2 G A 2: 82,981,197 G2620E possibly damaging Het
Glp1r C T 17: 30,909,323 A92V probably benign Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gm9573 A G 17: 35,621,978 S439P unknown Het
Gpr137b A T 13: 13,367,620 M204K probably damaging Het
Gstm1 A G 3: 108,016,377 V104A probably benign Het
Gtf2e1 A T 16: 37,535,866 N101K probably damaging Het
Igsf9b T C 9: 27,334,240 F1168L probably benign Het
Itpr2 A T 6: 146,294,091 V1629E probably damaging Het
Kat14 A G 2: 144,393,998 T428A probably benign Het
Kif21b T C 1: 136,149,448 Y403H probably damaging Het
Lpcat1 G C 13: 73,514,530 A533P probably benign Het
Lrp2 A T 2: 69,506,573 I1285N probably damaging Het
Mboat1 A T 13: 30,224,415 Y187F probably damaging Het
Mkx T C 18: 7,002,525 N7S probably damaging Het
Mrps27 A T 13: 99,414,799 T357S possibly damaging Het
Naa35 A G 13: 59,586,183 D9G probably benign Het
Ncoa4 T A 14: 32,175,983 N253K probably damaging Het
Neb A G 2: 52,270,306 Y2232H probably damaging Het
Nlk G A 11: 78,590,967 Q223* probably null Het
Npas2 T A 1: 39,292,717 I71N possibly damaging Het
Nup107 T A 10: 117,773,362 Q364L probably damaging Het
Olfr146 T A 9: 39,023,270 probably benign Het
Otof C T 5: 30,375,620 G1593S probably damaging Het
Panx3 G T 9: 37,664,085 H160Q probably damaging Het
Pappa T A 4: 65,261,873 H990Q probably damaging Het
Pax4 G A 6: 28,446,137 P119L probably damaging Het
Pcdhb20 T A 18: 37,505,070 D216E probably damaging Het
Pcdhgb8 T A 18: 37,763,178 S434T possibly damaging Het
Pf4 T C 5: 90,772,589 V3A probably benign Het
Phf24 T C 4: 42,938,325 S229P probably benign Het
Plcd3 A G 11: 103,079,613 F200S probably damaging Het
Ppp1r16a A G 15: 76,690,904 H4R probably damaging Het
Pramef20 A G 4: 144,372,819 C459R probably damaging Het
Prdm10 A G 9: 31,316,442 probably null Het
Prim2 A G 1: 33,628,393 probably null Het
Prkg1 T A 19: 30,585,199 H550L probably damaging Het
Prrc2c G T 1: 162,673,517 T2809N possibly damaging Het
Ptx3 A G 3: 66,224,970 E304G probably benign Het
Ralgps2 A G 1: 156,828,248 F369L probably benign Het
Rasgrp1 G A 2: 117,338,404 T31I probably benign Het
Rbsn A T 6: 92,191,334 M373K probably benign Het
Rnf168 C G 16: 32,282,361 R120G probably benign Het
Rp1 A G 1: 4,349,917 I324T probably damaging Het
Samd11 T C 4: 156,252,290 S31G probably benign Het
Sart3 A T 5: 113,745,995 L652Q probably benign Het
Scrn2 A G 11: 97,033,808 E421G probably benign Het
Sik2 A T 9: 50,917,097 L215Q probably damaging Het
Stard9 A T 2: 120,704,158 K3632M probably damaging Het
Swt1 A T 1: 151,388,677 D695E probably damaging Het
Tead3 T A 17: 28,333,254 M357L probably benign Het
Tgfbi A T 13: 56,628,016 T292S probably damaging Het
Tmc7 T C 7: 118,555,934 H247R probably benign Het
Trmt10b T A 4: 45,308,549 D236E probably damaging Het
Tshz1 C A 18: 84,015,927 V119L probably damaging Het
Ttn A C 2: 76,827,914 V12374G unknown Het
Tubgcp2 A G 7: 140,005,361 Y484H probably damaging Het
Ubr4 G C 4: 139,450,513 A1947P Het
Uggt1 A C 1: 36,155,107 V1350G probably benign Het
Vmn1r173 A T 7: 23,702,651 M104L probably benign Het
Xirp1 A T 9: 120,019,047 C257S probably damaging Het
Zfyve26 A G 12: 79,280,405 S724P probably damaging Het
Zmpste24 A T 4: 121,082,894 L185Q probably null Het
Zpld1 G A 16: 55,232,231 A340V probably benign Het
Other mutations in Asb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02879:Asb3 APN 11 31101067 missense probably damaging 1.00
IGL02932:Asb3 APN 11 31029067 critical splice donor site probably null
Kickbox UTSW 11 30998326 missense probably damaging 1.00
low_blow UTSW 11 30998348 nonsense probably null
Octagon UTSW 11 30998321 missense probably benign 0.34
penalty UTSW 11 31081357 splice site probably null
sixpack UTSW 11 31085143 missense probably benign
R0573:Asb3 UTSW 11 31061406 missense probably damaging 0.99
R1395:Asb3 UTSW 11 31101032 splice site probably benign
R1545:Asb3 UTSW 11 31056217 missense probably benign 0.00
R2108:Asb3 UTSW 11 31081355 splice site probably null
R2364:Asb3 UTSW 11 31101192 missense probably benign 0.01
R4527:Asb3 UTSW 11 31058933 missense probably benign 0.30
R5019:Asb3 UTSW 11 31081415 missense possibly damaging 0.95
R5176:Asb3 UTSW 11 31081357 splice site probably null
R5344:Asb3 UTSW 11 31101114 missense probably benign 0.01
R5734:Asb3 UTSW 11 31029021 missense probably damaging 1.00
R6251:Asb3 UTSW 11 31055559 missense probably damaging 1.00
R6265:Asb3 UTSW 11 31085143 missense probably benign
R6747:Asb3 UTSW 11 31081493 missense probably benign 0.01
R6827:Asb3 UTSW 11 31101211 missense probably benign 0.00
R6928:Asb3 UTSW 11 30998326 missense probably damaging 1.00
R7048:Asb3 UTSW 11 31101121 missense probably damaging 1.00
R7087:Asb3 UTSW 11 30998321 missense probably benign 0.34
R7135:Asb3 UTSW 11 30998501 nonsense probably null
R7200:Asb3 UTSW 11 30998348 nonsense probably null
R7265:Asb3 UTSW 11 30998495 missense probably benign 0.02
R7509:Asb3 UTSW 11 30998507 missense probably benign 0.12
R7674:Asb3 UTSW 11 31081435 missense possibly damaging 0.92
R8029:Asb3 UTSW 11 31101180 nonsense probably null
R8034:Asb3 UTSW 11 31081554 nonsense probably null
R8061:Asb3 UTSW 11 30998447 missense probably damaging 1.00
RF016:Asb3 UTSW 11 31061407 missense possibly damaging 0.95
X0024:Asb3 UTSW 11 31058950 missense probably damaging 0.97
Z1177:Asb3 UTSW 11 31058965 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CATGCCCAAGAAGTAGGACTG -3'
(R):5'- GTGCACAATGGGTTTTGCAGC -3'

Sequencing Primer
(F):5'- TGCCCAAGAAGTAGGACTGATAATC -3'
(R):5'- ATTTTCAAGTCCCAAATACTACTACC -3'
Posted On2019-06-26