Incidental Mutation 'R7166:Farsb'
ID557911
Institutional Source Beutler Lab
Gene Symbol Farsb
Ensembl Gene ENSMUSG00000026245
Gene Namephenylalanyl-tRNA synthetase, beta subunit
SynonymsFarsl, Frsb, PheRS alpha, Farslb
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_011811.3; MGI: 1346035

Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R7166 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location78417975-78488897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78471184 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 205 (N205S)
Ref Sequence ENSEMBL: ENSMUSP00000069508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068333] [ENSMUST00000170217] [ENSMUST00000188247] [ENSMUST00000189529] [ENSMUST00000190441]
Predicted Effect probably benign
Transcript: ENSMUST00000068333
AA Change: N205S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069508
Gene: ENSMUSG00000026245
AA Change: N205S

DomainStartEndE-ValueType
Blast:B3_4 56 95 6e-14 BLAST
B3_4 117 279 3.29e-29 SMART
B5 304 374 6.31e-17 SMART
SCOP:d1jjcb5 377 586 1e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170217
AA Change: N205S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129828
Gene: ENSMUSG00000026245
AA Change: N205S

DomainStartEndE-ValueType
Blast:B3_4 56 95 6e-14 BLAST
B3_4 117 279 3.29e-29 SMART
B5 304 374 6.31e-17 SMART
SCOP:d1jjcb5 377 586 1e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188247
AA Change: N106S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139933
Gene: ENSMUSG00000026245
AA Change: N106S

DomainStartEndE-ValueType
B3_4 18 180 2.5e-33 SMART
SCOP:d1jjcb2 204 237 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189529
SMART Domains Protein: ENSMUSP00000140001
Gene: ENSMUSG00000026245

DomainStartEndE-ValueType
PDB:3L4G|P 1 38 3e-20 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000190441
SMART Domains Protein: ENSMUSP00000140934
Gene: ENSMUSG00000026245

DomainStartEndE-ValueType
Blast:B3_4 89 128 3e-15 BLAST
Pfam:B3_4 150 206 1e-5 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved enzyme that belongs to the aminoacyl-tRNA synthetase class IIc subfamily. This enzyme comprises the regulatory beta subunits that form a tetramer with two catalytic alpha subunits. In the presence of ATP, this tetramer is responsible for attaching L-phenylalanine to the terminal adenosine of the appropriate tRNA. A pseudogene located on chromosome 10 has been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI

All alleles(15) : Targeted(2) Gene trapped(13)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambn T C 5: 88,467,528 L272P possibly damaging Het
Ash2l C A 8: 25,827,320 G335V probably damaging Het
Atp13a1 T A 8: 69,799,316 probably null Het
Atp13a2 G A 4: 141,006,984 R1139Q possibly damaging Het
Atxn2 T A 5: 121,796,397 N886K possibly damaging Het
Celsr3 G T 9: 108,842,951 C2512F probably damaging Het
Cfap221 A G 1: 119,948,113 V449A probably benign Het
Cfhr2 A T 1: 139,831,101 C70* probably null Het
Chfr C A 5: 110,158,805 P472Q probably benign Het
Crybg2 G A 4: 134,060,882 R22Q probably damaging Het
Eef2k T C 7: 120,884,772 F244L probably damaging Het
Efcab11 A T 12: 99,883,355 M23K Het
Ercc8 T A 13: 108,169,433 M114K possibly damaging Het
Fam217a T C 13: 34,910,315 Y487C probably benign Het
Glra1 A G 11: 55,515,078 F370S probably benign Het
Gm12258 T A 11: 58,858,473 M158K Het
Gm14305 T A 2: 176,720,943 H209Q probably damaging Het
Gm4924 A T 10: 82,378,201 Q611L unknown Het
Gm5580 A G 6: 116,551,368 I69V probably benign Het
Haus6 T C 4: 86,583,687 E649G possibly damaging Het
Hist1h4j A G 13: 21,735,151 H19R unknown Het
Hlcs C T 16: 94,262,726 D345N possibly damaging Het
Htt C A 5: 34,852,894 Q1564K probably benign Het
Itpr1 G A 6: 108,378,190 V481I probably benign Het
Jak3 T C 8: 71,682,316 I531T probably damaging Het
Kng1 T A 16: 23,079,678 H609Q probably benign Het
Mdn1 T A 4: 32,746,446 S4131T probably damaging Het
Npnt A G 3: 132,948,128 S31P probably damaging Het
Olfr1098 T A 2: 86,922,748 K261N probably damaging Het
Olfr1186 A T 2: 88,525,646 Q21L possibly damaging Het
Olfr398 A T 11: 73,984,295 F104L possibly damaging Het
Paxx A T 2: 25,460,226 L123Q probably damaging Het
Prdm13 C T 4: 21,683,528 R144Q unknown Het
Rab2b C A 14: 52,279,345 probably benign Het
Rnf207 A G 4: 152,311,780 I509T probably damaging Het
Ropn1l T C 15: 31,453,509 Q12R Het
Ryr3 T G 2: 112,875,028 Y847S probably damaging Het
Slc1a6 A T 10: 78,812,812 T456S possibly damaging Het
Slc26a2 A T 18: 61,198,829 M510K possibly damaging Het
Slc5a9 T C 4: 111,883,839 T537A probably benign Het
Slc9b2 T C 3: 135,326,178 Y132H unknown Het
Sltm T C 9: 70,584,850 L725S probably damaging Het
Spz1 A G 13: 92,575,927 C14R probably benign Het
Srrm4 T A 5: 116,471,242 Q172L unknown Het
Synj2bp T C 12: 81,504,515 D92G probably benign Het
Tmem169 A C 1: 72,301,070 T220P probably benign Het
Ttn T A 2: 76,888,028 I7270F unknown Het
Txndc16 T G 14: 45,183,154 N137H probably benign Het
Ubr5 A G 15: 37,976,145 Y2499H Het
Ugt2b38 T C 5: 87,410,446 D452G probably damaging Het
Zfp12 T A 5: 143,245,502 I560N possibly damaging Het
Zfp60 A G 7: 27,749,512 K535R possibly damaging Het
Zfp960 T A 17: 17,088,499 C492S probably damaging Het
Other mutations in Farsb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Farsb APN 1 78462993 missense probably benign 0.08
IGL01328:Farsb APN 1 78471092 missense probably benign 0.02
IGL01801:Farsb APN 1 78458579 missense probably benign 0.38
R0054:Farsb UTSW 1 78462374 nonsense probably null
R0054:Farsb UTSW 1 78462374 nonsense probably null
R1051:Farsb UTSW 1 78443650 missense possibly damaging 0.49
R1769:Farsb UTSW 1 78466983 missense probably benign 0.06
R4332:Farsb UTSW 1 78469266 missense possibly damaging 0.61
R4664:Farsb UTSW 1 78443765 missense possibly damaging 0.90
R4796:Farsb UTSW 1 78425196 makesense probably null
R4859:Farsb UTSW 1 78467972 missense probably benign 0.01
R5484:Farsb UTSW 1 78476196 missense probably damaging 1.00
R5500:Farsb UTSW 1 78471124 missense probably damaging 1.00
R5557:Farsb UTSW 1 78469251 critical splice donor site probably null
R6109:Farsb UTSW 1 78463270 critical splice donor site probably null
R6368:Farsb UTSW 1 78466965 critical splice donor site probably null
R6720:Farsb UTSW 1 78472497 missense probably damaging 1.00
R7184:Farsb UTSW 1 78482357 missense possibly damaging 0.86
R7233:Farsb UTSW 1 78471081 critical splice donor site probably null
R7536:Farsb UTSW 1 78443754 missense possibly damaging 0.89
R7753:Farsb UTSW 1 78480103 missense probably benign 0.25
R7824:Farsb UTSW 1 78469299 missense probably benign
R8120:Farsb UTSW 1 78462838 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCAATGACTAACTCACCCTACTG -3'
(R):5'- TCCTCACTCTGGTAGGAGAGAC -3'

Sequencing Primer
(F):5'- TGACTAACTCACCCTACTGAGAGTTC -3'
(R):5'- TCAGCTGGCTATAGCAG -3'
Posted On2019-06-26