Incidental Mutation 'R7166:Haus6'
ID557923
Institutional Source Beutler Lab
Gene Symbol Haus6
Ensembl Gene ENSMUSG00000038047
Gene NameHAUS augmin-like complex, subunit 6
Synonyms6230416J20Rik, D4Ertd27e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.684) question?
Stock #R7166 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location86578855-86612055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86583687 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 649 (E649G)
Ref Sequence ENSEMBL: ENSMUSP00000070504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070607]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070607
AA Change: E649G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000070504
Gene: ENSMUSG00000038047
AA Change: E649G

DomainStartEndE-ValueType
Pfam:HAUS6_N 14 238 1.1e-77 PFAM
low complexity region 613 624 N/A INTRINSIC
low complexity region 771 785 N/A INTRINSIC
low complexity region 915 927 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the augmin complex. The augmin complex plays a role in microtubule attachment to the kinetochore and central spindle formation. This protein may have a role in efficient chromosome congression and segregation by promoting microtubule-dependent microtubule amplification. Pseudogenes of this gene are located on chromosomes 7 and 20. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E2.5 and E7.5 with delayed or incomplete clustering of microtubule-organizing centers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambn T C 5: 88,467,528 L272P possibly damaging Het
Ash2l C A 8: 25,827,320 G335V probably damaging Het
Atp13a1 T A 8: 69,799,316 probably null Het
Atp13a2 G A 4: 141,006,984 R1139Q possibly damaging Het
Atxn2 T A 5: 121,796,397 N886K possibly damaging Het
Celsr3 G T 9: 108,842,951 C2512F probably damaging Het
Cfap221 A G 1: 119,948,113 V449A probably benign Het
Cfhr2 A T 1: 139,831,101 C70* probably null Het
Chfr C A 5: 110,158,805 P472Q probably benign Het
Crybg2 G A 4: 134,060,882 R22Q probably damaging Het
Eef2k T C 7: 120,884,772 F244L probably damaging Het
Efcab11 A T 12: 99,883,355 M23K Het
Ercc8 T A 13: 108,169,433 M114K possibly damaging Het
Fam217a T C 13: 34,910,315 Y487C probably benign Het
Farsb T C 1: 78,471,184 N205S probably benign Het
Glra1 A G 11: 55,515,078 F370S probably benign Het
Gm12258 T A 11: 58,858,473 M158K Het
Gm14305 T A 2: 176,720,943 H209Q probably damaging Het
Gm4924 A T 10: 82,378,201 Q611L unknown Het
Gm5580 A G 6: 116,551,368 I69V probably benign Het
Hist1h4j A G 13: 21,735,151 H19R unknown Het
Hlcs C T 16: 94,262,726 D345N possibly damaging Het
Htt C A 5: 34,852,894 Q1564K probably benign Het
Itpr1 G A 6: 108,378,190 V481I probably benign Het
Jak3 T C 8: 71,682,316 I531T probably damaging Het
Kng1 T A 16: 23,079,678 H609Q probably benign Het
Mdn1 T A 4: 32,746,446 S4131T probably damaging Het
Npnt A G 3: 132,948,128 S31P probably damaging Het
Olfr1098 T A 2: 86,922,748 K261N probably damaging Het
Olfr1186 A T 2: 88,525,646 Q21L possibly damaging Het
Olfr398 A T 11: 73,984,295 F104L possibly damaging Het
Paxx A T 2: 25,460,226 L123Q probably damaging Het
Prdm13 C T 4: 21,683,528 R144Q unknown Het
Rab2b C A 14: 52,279,345 probably benign Het
Rnf207 A G 4: 152,311,780 I509T probably damaging Het
Ropn1l T C 15: 31,453,509 Q12R Het
Ryr3 T G 2: 112,875,028 Y847S probably damaging Het
Slc1a6 A T 10: 78,812,812 T456S possibly damaging Het
Slc26a2 A T 18: 61,198,829 M510K possibly damaging Het
Slc5a9 T C 4: 111,883,839 T537A probably benign Het
Slc9b2 T C 3: 135,326,178 Y132H unknown Het
Sltm T C 9: 70,584,850 L725S probably damaging Het
Spz1 A G 13: 92,575,927 C14R probably benign Het
Srrm4 T A 5: 116,471,242 Q172L unknown Het
Synj2bp T C 12: 81,504,515 D92G probably benign Het
Tmem169 A C 1: 72,301,070 T220P probably benign Het
Ttn T A 2: 76,888,028 I7270F unknown Het
Txndc16 T G 14: 45,183,154 N137H probably benign Het
Ubr5 A G 15: 37,976,145 Y2499H Het
Ugt2b38 T C 5: 87,410,446 D452G probably damaging Het
Zfp12 T A 5: 143,245,502 I560N possibly damaging Het
Zfp60 A G 7: 27,749,512 K535R possibly damaging Het
Zfp960 T A 17: 17,088,499 C492S probably damaging Het
Other mutations in Haus6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Haus6 APN 4 86607981 missense probably benign 0.32
IGL02307:Haus6 APN 4 86583835 missense possibly damaging 0.53
IGL03113:Haus6 APN 4 86583106 nonsense probably null
IGL03384:Haus6 APN 4 86583525 missense probably benign
R0436:Haus6 UTSW 4 86585807 missense probably benign 0.00
R0491:Haus6 UTSW 4 86602846 missense possibly damaging 0.93
R0620:Haus6 UTSW 4 86583514 missense possibly damaging 0.53
R1118:Haus6 UTSW 4 86585326 critical splice donor site probably null
R1969:Haus6 UTSW 4 86604246 missense probably damaging 0.99
R1985:Haus6 UTSW 4 86593609 missense possibly damaging 0.96
R2213:Haus6 UTSW 4 86581992 missense possibly damaging 0.53
R2448:Haus6 UTSW 4 86589001 missense possibly damaging 0.53
R2567:Haus6 UTSW 4 86585885 nonsense probably null
R2760:Haus6 UTSW 4 86583176 nonsense probably null
R3714:Haus6 UTSW 4 86602867 missense probably benign 0.01
R3962:Haus6 UTSW 4 86611804 missense possibly damaging 0.85
R4180:Haus6 UTSW 4 86583574 missense probably benign 0.00
R4736:Haus6 UTSW 4 86600749 critical splice donor site probably null
R4738:Haus6 UTSW 4 86600749 critical splice donor site probably null
R4929:Haus6 UTSW 4 86595433 missense probably benign 0.03
R4933:Haus6 UTSW 4 86585287 intron probably benign
R5027:Haus6 UTSW 4 86605696 missense possibly damaging 0.92
R5199:Haus6 UTSW 4 86582985 missense possibly damaging 0.85
R5240:Haus6 UTSW 4 86583178 missense possibly damaging 0.86
R5580:Haus6 UTSW 4 86599266 missense possibly damaging 0.73
R5781:Haus6 UTSW 4 86601263 missense possibly damaging 0.92
R5865:Haus6 UTSW 4 86586357 missense possibly damaging 0.73
R5926:Haus6 UTSW 4 86599316 missense probably benign
R6154:Haus6 UTSW 4 86583756 missense possibly damaging 0.96
R7183:Haus6 UTSW 4 86583752 missense possibly damaging 0.53
R7418:Haus6 UTSW 4 86594773 missense possibly damaging 0.73
R7843:Haus6 UTSW 4 86586341 missense possibly damaging 0.85
R7926:Haus6 UTSW 4 86586341 missense possibly damaging 0.85
Z1088:Haus6 UTSW 4 86602874 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AGAAGCTTGTGAGTGGTCCG -3'
(R):5'- GCTCATGGAGAAAAGCTGTTG -3'

Sequencing Primer
(F):5'- CAGGGGAGAATACATCCATGTGAC -3'
(R):5'- CTCATGGAGAAAAGCTGTTGAAACTG -3'
Posted On2019-06-26