Incidental Mutation 'R7166:Atxn2'
ID 557933
Institutional Source Beutler Lab
Gene Symbol Atxn2
Ensembl Gene ENSMUSG00000042605
Gene Name ataxin 2
Synonyms 9630045M23Rik, ATX2, Sca2
MMRRC Submission 045227-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.783) question?
Stock # R7166 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 121849672-121954372 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 121934460 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 886 (N886K)
Ref Sequence ENSEMBL: ENSMUSP00000056715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051950] [ENSMUST00000161064] [ENSMUST00000162327]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000051950
AA Change: N886K

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056715
Gene: ENSMUSG00000042605
AA Change: N886K

DomainStartEndE-ValueType
low complexity region 32 42 N/A INTRINSIC
low complexity region 46 69 N/A INTRINSIC
low complexity region 93 116 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 168 219 N/A INTRINSIC
Pfam:SM-ATX 236 307 6.4e-23 PFAM
LsmAD 378 446 8.57e-25 SMART
low complexity region 520 540 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
low complexity region 685 705 N/A INTRINSIC
low complexity region 807 838 N/A INTRINSIC
low complexity region 864 879 N/A INTRINSIC
Pfam:PAM2 880 897 5.7e-9 PFAM
low complexity region 1128 1165 N/A INTRINSIC
low complexity region 1185 1196 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160821
SMART Domains Protein: ENSMUSP00000125647
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
Pfam:LsmAD 1 47 3.6e-11 PFAM
low complexity region 217 237 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161064
AA Change: N577K

PolyPhen 2 Score 0.536 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124070
Gene: ENSMUSG00000042605
AA Change: N577K

DomainStartEndE-ValueType
LsmAD 69 137 8.57e-25 SMART
low complexity region 211 231 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 498 529 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Pfam:PAM2 571 588 3.5e-9 PFAM
low complexity region 801 838 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
low complexity region 915 923 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162327
AA Change: N282K

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123784
Gene: ENSMUSG00000042605
AA Change: N282K

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:PAM2 74 91 1.3e-9 PFAM
low complexity region 302 339 N/A INTRINSIC
low complexity region 359 370 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mice exhibit an enlarged fat pad, hepatic steatosis and enlarged seminal vesicles. A mild defect in motor learning is seen, but no other notable behavioral or neurological defects are detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambn T C 5: 88,615,387 (GRCm39) L272P possibly damaging Het
Ash2l C A 8: 26,317,348 (GRCm39) G335V probably damaging Het
Atp13a1 T A 8: 70,251,966 (GRCm39) probably null Het
Atp13a2 G A 4: 140,734,295 (GRCm39) R1139Q possibly damaging Het
Celsr3 G T 9: 108,720,150 (GRCm39) C2512F probably damaging Het
Cfap221 A G 1: 119,875,843 (GRCm39) V449A probably benign Het
Cfhr2 A T 1: 139,758,839 (GRCm39) C70* probably null Het
Chfr C A 5: 110,306,671 (GRCm39) P472Q probably benign Het
Crybg2 G A 4: 133,788,193 (GRCm39) R22Q probably damaging Het
Eef2k T C 7: 120,483,995 (GRCm39) F244L probably damaging Het
Efcab11 A T 12: 99,849,614 (GRCm39) M23K Het
Eif4a3l2 A G 6: 116,528,329 (GRCm39) I69V probably benign Het
Ercc8 T A 13: 108,305,967 (GRCm39) M114K possibly damaging Het
Fam217a T C 13: 35,094,298 (GRCm39) Y487C probably benign Het
Farsb T C 1: 78,447,821 (GRCm39) N205S probably benign Het
Glra1 A G 11: 55,405,904 (GRCm39) F370S probably benign Het
Gm12258 T A 11: 58,749,299 (GRCm39) M158K Het
Gm14305 T A 2: 176,412,736 (GRCm39) H209Q probably damaging Het
Gm4924 A T 10: 82,214,035 (GRCm39) Q611L unknown Het
H4c11 A G 13: 21,919,321 (GRCm39) H19R unknown Het
Haus6 T C 4: 86,501,924 (GRCm39) E649G possibly damaging Het
Hlcs C T 16: 94,063,585 (GRCm39) D345N possibly damaging Het
Htt C A 5: 35,010,238 (GRCm39) Q1564K probably benign Het
Itpr1 G A 6: 108,355,151 (GRCm39) V481I probably benign Het
Jak3 T C 8: 72,134,960 (GRCm39) I531T probably damaging Het
Kng1 T A 16: 22,898,428 (GRCm39) H609Q probably benign Het
Mdn1 T A 4: 32,746,446 (GRCm39) S4131T probably damaging Het
Npnt A G 3: 132,653,889 (GRCm39) S31P probably damaging Het
Or1r1 A T 11: 73,875,121 (GRCm39) F104L possibly damaging Het
Or4c100 A T 2: 88,355,990 (GRCm39) Q21L possibly damaging Het
Or8h8 T A 2: 86,753,092 (GRCm39) K261N probably damaging Het
Paxx A T 2: 25,350,238 (GRCm39) L123Q probably damaging Het
Prdm13 C T 4: 21,683,528 (GRCm39) R144Q unknown Het
Rab2b C A 14: 52,516,802 (GRCm39) probably benign Het
Rnf207 A G 4: 152,396,237 (GRCm39) I509T probably damaging Het
Ropn1l T C 15: 31,453,655 (GRCm39) Q12R Het
Ryr3 T G 2: 112,705,373 (GRCm39) Y847S probably damaging Het
Slc1a6 A T 10: 78,648,646 (GRCm39) T456S possibly damaging Het
Slc26a2 A T 18: 61,331,901 (GRCm39) M510K possibly damaging Het
Slc5a9 T C 4: 111,741,036 (GRCm39) T537A probably benign Het
Slc9b2 T C 3: 135,031,939 (GRCm39) Y132H unknown Het
Sltm T C 9: 70,492,132 (GRCm39) L725S probably damaging Het
Spz1 A G 13: 92,712,435 (GRCm39) C14R probably benign Het
Srrm4 T A 5: 116,609,301 (GRCm39) Q172L unknown Het
Synj2bp T C 12: 81,551,289 (GRCm39) D92G probably benign Het
Tmem169 A C 1: 72,340,229 (GRCm39) T220P probably benign Het
Ttn T A 2: 76,718,372 (GRCm39) I7270F unknown Het
Txndc16 T G 14: 45,420,611 (GRCm39) N137H probably benign Het
Ubr5 A G 15: 37,976,389 (GRCm39) Y2499H Het
Ugt2b38 T C 5: 87,558,305 (GRCm39) D452G probably damaging Het
Zfp12 T A 5: 143,231,257 (GRCm39) I560N possibly damaging Het
Zfp60 A G 7: 27,448,937 (GRCm39) K535R possibly damaging Het
Zfp960 T A 17: 17,308,761 (GRCm39) C492S probably damaging Het
Other mutations in Atxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Atxn2 APN 5 121,933,118 (GRCm39) missense probably benign 0.00
IGL00798:Atxn2 APN 5 121,933,298 (GRCm39) missense possibly damaging 0.58
IGL01518:Atxn2 APN 5 121,949,042 (GRCm39) missense probably damaging 1.00
IGL01737:Atxn2 APN 5 121,935,407 (GRCm39) missense probably damaging 0.98
IGL01832:Atxn2 APN 5 121,944,331 (GRCm39) nonsense probably null
IGL02122:Atxn2 APN 5 121,916,093 (GRCm39) missense probably damaging 1.00
IGL02333:Atxn2 APN 5 121,919,450 (GRCm39) missense probably damaging 1.00
IGL02742:Atxn2 APN 5 121,919,399 (GRCm39) missense possibly damaging 0.75
IGL03028:Atxn2 APN 5 121,948,972 (GRCm39) missense probably damaging 1.00
IGL03282:Atxn2 APN 5 121,923,298 (GRCm39) missense probably benign 0.00
R0387:Atxn2 UTSW 5 121,940,206 (GRCm39) missense possibly damaging 0.83
R0653:Atxn2 UTSW 5 121,910,841 (GRCm39) missense probably damaging 0.99
R0849:Atxn2 UTSW 5 121,885,484 (GRCm39) splice site probably null
R1305:Atxn2 UTSW 5 121,887,247 (GRCm39) missense probably damaging 1.00
R1440:Atxn2 UTSW 5 121,941,145 (GRCm39) critical splice donor site probably null
R1471:Atxn2 UTSW 5 121,924,437 (GRCm39) missense probably damaging 1.00
R1521:Atxn2 UTSW 5 121,917,654 (GRCm39) missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121,951,593 (GRCm39) missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121,940,171 (GRCm39) missense probably damaging 0.99
R2083:Atxn2 UTSW 5 121,922,069 (GRCm39) missense probably benign 0.00
R2197:Atxn2 UTSW 5 121,944,280 (GRCm39) splice site probably null
R2217:Atxn2 UTSW 5 121,941,140 (GRCm39) missense probably damaging 1.00
R2218:Atxn2 UTSW 5 121,941,140 (GRCm39) missense probably damaging 1.00
R2420:Atxn2 UTSW 5 121,940,142 (GRCm39) critical splice acceptor site probably null
R2421:Atxn2 UTSW 5 121,940,142 (GRCm39) critical splice acceptor site probably null
R2510:Atxn2 UTSW 5 121,919,456 (GRCm39) missense probably damaging 1.00
R3706:Atxn2 UTSW 5 121,923,931 (GRCm39) critical splice donor site probably null
R4604:Atxn2 UTSW 5 121,919,406 (GRCm39) missense probably damaging 1.00
R4852:Atxn2 UTSW 5 121,952,474 (GRCm39) missense probably damaging 0.97
R4914:Atxn2 UTSW 5 121,887,159 (GRCm39) missense probably damaging 1.00
R4982:Atxn2 UTSW 5 121,952,406 (GRCm39) missense possibly damaging 0.66
R5172:Atxn2 UTSW 5 121,933,098 (GRCm39) splice site probably null
R5213:Atxn2 UTSW 5 121,952,543 (GRCm39) splice site probably null
R5655:Atxn2 UTSW 5 121,885,489 (GRCm39) missense probably damaging 0.97
R5775:Atxn2 UTSW 5 121,951,512 (GRCm39) missense probably damaging 1.00
R5782:Atxn2 UTSW 5 121,935,373 (GRCm39) missense probably damaging 1.00
R6015:Atxn2 UTSW 5 121,949,055 (GRCm39) missense probably damaging 1.00
R6438:Atxn2 UTSW 5 121,917,495 (GRCm39) missense probably damaging 1.00
R6529:Atxn2 UTSW 5 121,949,677 (GRCm39) critical splice donor site probably null
R6659:Atxn2 UTSW 5 121,916,027 (GRCm39) missense probably benign 0.10
R6864:Atxn2 UTSW 5 121,917,557 (GRCm39) missense probably damaging 1.00
R7035:Atxn2 UTSW 5 121,949,530 (GRCm39) nonsense probably null
R7253:Atxn2 UTSW 5 121,916,084 (GRCm39) missense probably damaging 1.00
R7257:Atxn2 UTSW 5 121,923,880 (GRCm39) missense possibly damaging 0.62
R7467:Atxn2 UTSW 5 121,940,330 (GRCm39) critical splice donor site probably null
R7544:Atxn2 UTSW 5 121,919,431 (GRCm39) missense probably damaging 1.00
R7648:Atxn2 UTSW 5 121,934,440 (GRCm39) missense probably damaging 0.99
R7883:Atxn2 UTSW 5 121,940,180 (GRCm39) missense possibly damaging 0.79
R8097:Atxn2 UTSW 5 121,887,286 (GRCm39) missense probably damaging 1.00
R8784:Atxn2 UTSW 5 121,933,091 (GRCm39) missense probably benign 0.00
R8835:Atxn2 UTSW 5 121,940,248 (GRCm39) missense possibly damaging 0.63
R8880:Atxn2 UTSW 5 121,948,973 (GRCm39) missense probably benign 0.24
R8983:Atxn2 UTSW 5 121,916,063 (GRCm39) missense probably damaging 1.00
R9254:Atxn2 UTSW 5 121,885,509 (GRCm39) missense probably damaging 1.00
R9332:Atxn2 UTSW 5 121,923,425 (GRCm39) missense probably damaging 1.00
R9379:Atxn2 UTSW 5 121,885,509 (GRCm39) missense probably damaging 1.00
R9412:Atxn2 UTSW 5 121,940,201 (GRCm39) missense possibly damaging 0.84
R9649:Atxn2 UTSW 5 121,949,055 (GRCm39) missense probably damaging 0.98
R9656:Atxn2 UTSW 5 121,922,061 (GRCm39) missense possibly damaging 0.78
X0028:Atxn2 UTSW 5 121,940,146 (GRCm39) missense probably benign 0.01
Z1176:Atxn2 UTSW 5 121,916,053 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAGCAGCAGAGGTGTGTG -3'
(R):5'- AGTCGTTGTGAGCTTACACTGAG -3'

Sequencing Primer
(F):5'- CAGCAGAGGTGTGTGTTTCAGTAAAG -3'
(R):5'- ACTGACAAGCTTGGGGACATCC -3'
Posted On 2019-06-26