Incidental Mutation 'R7166:Zfp12'
ID557934
Institutional Source Beutler Lab
Gene Symbol Zfp12
Ensembl Gene ENSMUSG00000029587
Gene Namezinc finger protein 12
SynonymsZfp-12, Krox-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R7166 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location143235163-143248834 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143245502 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 560 (I560N)
Ref Sequence ENSEMBL: ENSMUSP00000032591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032591] [ENSMUST00000075916] [ENSMUST00000077485] [ENSMUST00000161448]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032591
AA Change: I560N

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032591
Gene: ENSMUSG00000029587
AA Change: I560N

DomainStartEndE-ValueType
KRAB 8 68 1.98e-36 SMART
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 263 285 4.47e-3 SMART
ZnF_C2H2 291 313 2.43e-4 SMART
ZnF_C2H2 319 341 2.61e-4 SMART
ZnF_C2H2 347 369 1.04e-3 SMART
ZnF_C2H2 375 397 6.08e-5 SMART
ZnF_C2H2 403 425 2.99e-4 SMART
ZnF_C2H2 431 453 9.08e-4 SMART
ZnF_C2H2 459 481 2.57e-3 SMART
ZnF_C2H2 487 509 6.32e-3 SMART
ZnF_C2H2 515 537 5.21e-4 SMART
ZnF_C2H2 543 565 9.44e-2 SMART
ZnF_C2H2 571 593 1.72e-4 SMART
ZnF_C2H2 599 621 2.86e-1 SMART
ZnF_C2H2 627 649 3.63e-3 SMART
ZnF_C2H2 655 677 4.54e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075916
SMART Domains Protein: ENSMUSP00000137971
Gene: ENSMUSG00000029587

DomainStartEndE-ValueType
KRAB 8 67 6.65e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077485
AA Change: I528N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076693
Gene: ENSMUSG00000029587
AA Change: I528N

DomainStartEndE-ValueType
KRAB 8 68 8.91e-21 SMART
low complexity region 156 167 N/A INTRINSIC
Pfam:zf-C2H2_6 183 200 8.8e-1 PFAM
ZnF_C2H2 231 253 4.47e-3 SMART
ZnF_C2H2 259 281 2.43e-4 SMART
ZnF_C2H2 287 309 2.61e-4 SMART
ZnF_C2H2 315 337 1.04e-3 SMART
ZnF_C2H2 343 365 6.08e-5 SMART
ZnF_C2H2 371 393 2.99e-4 SMART
ZnF_C2H2 399 421 9.08e-4 SMART
ZnF_C2H2 427 449 2.57e-3 SMART
ZnF_C2H2 455 477 6.32e-3 SMART
ZnF_C2H2 483 505 5.21e-4 SMART
ZnF_C2H2 511 533 9.44e-2 SMART
ZnF_C2H2 539 561 1.72e-4 SMART
ZnF_C2H2 567 589 2.86e-1 SMART
ZnF_C2H2 595 617 3.63e-3 SMART
ZnF_C2H2 623 645 4.54e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161448
SMART Domains Protein: ENSMUSP00000125416
Gene: ENSMUSG00000046658

DomainStartEndE-ValueType
low complexity region 30 68 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
KRAB 155 215 4.31e-37 SMART
low complexity region 239 262 N/A INTRINSIC
ZnF_C2H2 341 363 1.58e-3 SMART
ZnF_C2H2 369 391 1.45e-2 SMART
ZnF_C2H2 397 419 6.88e-4 SMART
ZnF_C2H2 425 447 3.63e-3 SMART
ZnF_C2H2 453 475 1.2e-3 SMART
ZnF_C2H2 481 501 2.17e1 SMART
low complexity region 524 558 N/A INTRINSIC
low complexity region 568 584 N/A INTRINSIC
low complexity region 649 664 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
ZnF_C2H2 708 730 1.2e-3 SMART
ZnF_C2H2 736 758 3.58e-2 SMART
ZnF_C2H2 764 786 1.45e-2 SMART
ZnF_C2H2 792 814 1.99e0 SMART
ZnF_C2H2 820 842 2.82e0 SMART
ZnF_C2H2 848 870 7.9e-4 SMART
ZnF_C2H2 876 898 1.45e-2 SMART
ZnF_C2H2 904 926 9.88e-5 SMART
ZnF_C2H2 932 954 2.09e-3 SMART
low complexity region 964 990 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the krueppel C2H2-type zinc-finger protein family and encodes a protein with eight C2H2-type zinc fingers and a KRAB domain. This nuclear protein is involved in developmental control of gene expression. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambn T C 5: 88,467,528 L272P possibly damaging Het
Ash2l C A 8: 25,827,320 G335V probably damaging Het
Atp13a1 T A 8: 69,799,316 probably null Het
Atp13a2 G A 4: 141,006,984 R1139Q possibly damaging Het
Atxn2 T A 5: 121,796,397 N886K possibly damaging Het
Celsr3 G T 9: 108,842,951 C2512F probably damaging Het
Cfap221 A G 1: 119,948,113 V449A probably benign Het
Cfhr2 A T 1: 139,831,101 C70* probably null Het
Chfr C A 5: 110,158,805 P472Q probably benign Het
Crybg2 G A 4: 134,060,882 R22Q probably damaging Het
Eef2k T C 7: 120,884,772 F244L probably damaging Het
Efcab11 A T 12: 99,883,355 M23K Het
Ercc8 T A 13: 108,169,433 M114K possibly damaging Het
Fam217a T C 13: 34,910,315 Y487C probably benign Het
Farsb T C 1: 78,471,184 N205S probably benign Het
Glra1 A G 11: 55,515,078 F370S probably benign Het
Gm12258 T A 11: 58,858,473 M158K Het
Gm14305 T A 2: 176,720,943 H209Q probably damaging Het
Gm4924 A T 10: 82,378,201 Q611L unknown Het
Gm5580 A G 6: 116,551,368 I69V probably benign Het
Haus6 T C 4: 86,583,687 E649G possibly damaging Het
Hist1h4j A G 13: 21,735,151 H19R unknown Het
Hlcs C T 16: 94,262,726 D345N possibly damaging Het
Htt C A 5: 34,852,894 Q1564K probably benign Het
Itpr1 G A 6: 108,378,190 V481I probably benign Het
Jak3 T C 8: 71,682,316 I531T probably damaging Het
Kng1 T A 16: 23,079,678 H609Q probably benign Het
Mdn1 T A 4: 32,746,446 S4131T probably damaging Het
Npnt A G 3: 132,948,128 S31P probably damaging Het
Olfr1098 T A 2: 86,922,748 K261N probably damaging Het
Olfr1186 A T 2: 88,525,646 Q21L possibly damaging Het
Olfr398 A T 11: 73,984,295 F104L possibly damaging Het
Paxx A T 2: 25,460,226 L123Q probably damaging Het
Prdm13 C T 4: 21,683,528 R144Q unknown Het
Rab2b C A 14: 52,279,345 probably benign Het
Rnf207 A G 4: 152,311,780 I509T probably damaging Het
Ropn1l T C 15: 31,453,509 Q12R Het
Ryr3 T G 2: 112,875,028 Y847S probably damaging Het
Slc1a6 A T 10: 78,812,812 T456S possibly damaging Het
Slc26a2 A T 18: 61,198,829 M510K possibly damaging Het
Slc5a9 T C 4: 111,883,839 T537A probably benign Het
Slc9b2 T C 3: 135,326,178 Y132H unknown Het
Sltm T C 9: 70,584,850 L725S probably damaging Het
Spz1 A G 13: 92,575,927 C14R probably benign Het
Srrm4 T A 5: 116,471,242 Q172L unknown Het
Synj2bp T C 12: 81,504,515 D92G probably benign Het
Tmem169 A C 1: 72,301,070 T220P probably benign Het
Ttn T A 2: 76,888,028 I7270F unknown Het
Txndc16 T G 14: 45,183,154 N137H probably benign Het
Ubr5 A G 15: 37,976,145 Y2499H Het
Ugt2b38 T C 5: 87,410,446 D452G probably damaging Het
Zfp60 A G 7: 27,749,512 K535R possibly damaging Het
Zfp960 T A 17: 17,088,499 C492S probably damaging Het
Other mutations in Zfp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02471:Zfp12 APN 5 143244796 missense probably damaging 1.00
IGL02870:Zfp12 APN 5 143245331 missense probably damaging 0.99
IGL02975:Zfp12 APN 5 143244059 unclassified probably benign
R0362:Zfp12 UTSW 5 143245223 missense probably damaging 0.97
R0723:Zfp12 UTSW 5 143244883 missense probably damaging 1.00
R1104:Zfp12 UTSW 5 143245745 missense probably damaging 1.00
R1403:Zfp12 UTSW 5 143244780 nonsense probably null
R1403:Zfp12 UTSW 5 143244780 nonsense probably null
R1774:Zfp12 UTSW 5 143245229 missense probably damaging 1.00
R1895:Zfp12 UTSW 5 143245378 missense probably damaging 1.00
R1946:Zfp12 UTSW 5 143245378 missense probably damaging 1.00
R2280:Zfp12 UTSW 5 143245493 missense probably damaging 0.99
R3824:Zfp12 UTSW 5 143240322 missense probably benign 0.12
R4772:Zfp12 UTSW 5 143240000 missense probably damaging 1.00
R4786:Zfp12 UTSW 5 143245502 missense probably damaging 0.99
R5255:Zfp12 UTSW 5 143240379 missense probably null 0.08
R5496:Zfp12 UTSW 5 143244795 nonsense probably null
R5542:Zfp12 UTSW 5 143244485 missense possibly damaging 0.75
R5637:Zfp12 UTSW 5 143245696 missense probably damaging 1.00
R5742:Zfp12 UTSW 5 143245190 missense probably damaging 1.00
R5907:Zfp12 UTSW 5 143239988 missense probably damaging 1.00
R6701:Zfp12 UTSW 5 143244464 missense probably benign 0.21
R7188:Zfp12 UTSW 5 143239994 missense probably damaging 0.99
R7285:Zfp12 UTSW 5 143244689 missense probably damaging 1.00
R7404:Zfp12 UTSW 5 143240344 missense probably damaging 1.00
R7902:Zfp12 UTSW 5 143245780 missense probably damaging 0.99
R7985:Zfp12 UTSW 5 143245780 missense probably damaging 0.99
R8085:Zfp12 UTSW 5 143244926 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTGGCAAGACGTTCTCTC -3'
(R):5'- TACGACATCCGAGAGAAGGC -3'

Sequencing Primer
(F):5'- GGGAAGTCCTTCTACCTGAACTCAG -3'
(R):5'- GACATCCGAGAGAAGGCTTTCC -3'
Posted On2019-06-26