Incidental Mutation 'R7166:Ash2l'
ID557939
Institutional Source Beutler Lab
Gene Symbol Ash2l
Ensembl Gene ENSMUSG00000031575
Gene NameASH2 like histone lysine methyltransferase complex subunit
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7166 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location25815996-25847694 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25827320 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 335 (G335V)
Ref Sequence ENSEMBL: ENSMUSP00000070957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068892] [ENSMUST00000110608] [ENSMUST00000110609] [ENSMUST00000110610] [ENSMUST00000139946] [ENSMUST00000151856] [ENSMUST00000166078]
Predicted Effect probably damaging
Transcript: ENSMUST00000068892
AA Change: G335V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070957
Gene: ENSMUSG00000031575
AA Change: G335V

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 36 59 N/A INTRINSIC
PDB:3S32|A 90 275 1e-136 PDB
Blast:PHD 103 146 2e-6 BLAST
low complexity region 280 306 N/A INTRINSIC
SPRY 413 577 4.87e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110608
AA Change: G246V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106238
Gene: ENSMUSG00000031575
AA Change: G246V

DomainStartEndE-ValueType
PDB:3S32|A 1 186 1e-137 PDB
Blast:PHD 14 57 2e-6 BLAST
low complexity region 191 217 N/A INTRINSIC
SPRY 324 455 1.13e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110609
AA Change: G246V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106239
Gene: ENSMUSG00000031575
AA Change: G246V

DomainStartEndE-ValueType
PDB:3S32|A 1 186 1e-137 PDB
Blast:PHD 14 57 2e-6 BLAST
low complexity region 191 217 N/A INTRINSIC
SPRY 324 488 4.87e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110610
AA Change: G246V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106240
Gene: ENSMUSG00000031575
AA Change: G246V

DomainStartEndE-ValueType
PDB:3S32|A 1 186 1e-137 PDB
Blast:PHD 14 57 2e-6 BLAST
low complexity region 191 217 N/A INTRINSIC
SPRY 324 488 4.87e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000139946
AA Change: A304S

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118346
Gene: ENSMUSG00000031575
AA Change: A304S

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 36 59 N/A INTRINSIC
PDB:3S32|A 90 275 1e-141 PDB
Blast:PHD 103 146 1e-6 BLAST
transmembrane domain 278 300 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000151856
AA Change: A310S

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117488
Gene: ENSMUSG00000031575
AA Change: A310S

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 36 59 N/A INTRINSIC
PDB:3S32|A 90 272 1e-125 PDB
Blast:PHD 103 146 1e-6 BLAST
transmembrane domain 286 305 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166078
AA Change: G246V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132546
Gene: ENSMUSG00000031575
AA Change: G246V

DomainStartEndE-ValueType
PDB:3S32|A 1 186 1e-137 PDB
Blast:PHD 14 57 2e-6 BLAST
low complexity region 191 217 N/A INTRINSIC
SPRY 324 488 4.87e-41 SMART
Meta Mutation Damage Score 0.7262 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele die before E8.5-E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambn T C 5: 88,467,528 L272P possibly damaging Het
Atp13a1 T A 8: 69,799,316 probably null Het
Atp13a2 G A 4: 141,006,984 R1139Q possibly damaging Het
Atxn2 T A 5: 121,796,397 N886K possibly damaging Het
Celsr3 G T 9: 108,842,951 C2512F probably damaging Het
Cfap221 A G 1: 119,948,113 V449A probably benign Het
Cfhr2 A T 1: 139,831,101 C70* probably null Het
Chfr C A 5: 110,158,805 P472Q probably benign Het
Crybg2 G A 4: 134,060,882 R22Q probably damaging Het
Eef2k T C 7: 120,884,772 F244L probably damaging Het
Efcab11 A T 12: 99,883,355 M23K Het
Ercc8 T A 13: 108,169,433 M114K possibly damaging Het
Fam217a T C 13: 34,910,315 Y487C probably benign Het
Farsb T C 1: 78,471,184 N205S probably benign Het
Glra1 A G 11: 55,515,078 F370S probably benign Het
Gm12258 T A 11: 58,858,473 M158K Het
Gm14305 T A 2: 176,720,943 H209Q probably damaging Het
Gm4924 A T 10: 82,378,201 Q611L unknown Het
Gm5580 A G 6: 116,551,368 I69V probably benign Het
Haus6 T C 4: 86,583,687 E649G possibly damaging Het
Hist1h4j A G 13: 21,735,151 H19R unknown Het
Hlcs C T 16: 94,262,726 D345N possibly damaging Het
Htt C A 5: 34,852,894 Q1564K probably benign Het
Itpr1 G A 6: 108,378,190 V481I probably benign Het
Jak3 T C 8: 71,682,316 I531T probably damaging Het
Kng1 T A 16: 23,079,678 H609Q probably benign Het
Mdn1 T A 4: 32,746,446 S4131T probably damaging Het
Npnt A G 3: 132,948,128 S31P probably damaging Het
Olfr1098 T A 2: 86,922,748 K261N probably damaging Het
Olfr1186 A T 2: 88,525,646 Q21L possibly damaging Het
Olfr398 A T 11: 73,984,295 F104L possibly damaging Het
Paxx A T 2: 25,460,226 L123Q probably damaging Het
Prdm13 C T 4: 21,683,528 R144Q unknown Het
Rab2b C A 14: 52,279,345 probably benign Het
Rnf207 A G 4: 152,311,780 I509T probably damaging Het
Ropn1l T C 15: 31,453,509 Q12R Het
Ryr3 T G 2: 112,875,028 Y847S probably damaging Het
Slc1a6 A T 10: 78,812,812 T456S possibly damaging Het
Slc26a2 A T 18: 61,198,829 M510K possibly damaging Het
Slc5a9 T C 4: 111,883,839 T537A probably benign Het
Slc9b2 T C 3: 135,326,178 Y132H unknown Het
Sltm T C 9: 70,584,850 L725S probably damaging Het
Spz1 A G 13: 92,575,927 C14R probably benign Het
Srrm4 T A 5: 116,471,242 Q172L unknown Het
Synj2bp T C 12: 81,504,515 D92G probably benign Het
Tmem169 A C 1: 72,301,070 T220P probably benign Het
Ttn T A 2: 76,888,028 I7270F unknown Het
Txndc16 T G 14: 45,183,154 N137H probably benign Het
Ubr5 A G 15: 37,976,145 Y2499H Het
Ugt2b38 T C 5: 87,410,446 D452G probably damaging Het
Zfp12 T A 5: 143,245,502 I560N possibly damaging Het
Zfp60 A G 7: 27,749,512 K535R possibly damaging Het
Zfp960 T A 17: 17,088,499 C492S probably damaging Het
Other mutations in Ash2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01835:Ash2l APN 8 25839840 missense probably damaging 1.00
IGL01913:Ash2l APN 8 25819624 critical splice donor site probably null
IGL02379:Ash2l APN 8 25822771 missense probably damaging 1.00
IGL03149:Ash2l APN 8 25818622 missense probably benign 0.00
R0639:Ash2l UTSW 8 25823291 missense possibly damaging 0.83
R1217:Ash2l UTSW 8 25822885 missense probably damaging 0.97
R1244:Ash2l UTSW 8 25817421 missense probably damaging 0.99
R1440:Ash2l UTSW 8 25827378 missense probably benign 0.27
R2282:Ash2l UTSW 8 25835042 missense probably damaging 0.99
R3013:Ash2l UTSW 8 25839764 missense probably damaging 0.96
R3721:Ash2l UTSW 8 25818625 missense probably damaging 1.00
R4155:Ash2l UTSW 8 25817454 missense probably damaging 1.00
R4727:Ash2l UTSW 8 25818595 missense probably damaging 0.99
R5637:Ash2l UTSW 8 25827311 missense probably damaging 1.00
R5973:Ash2l UTSW 8 25817614 missense possibly damaging 0.93
R6473:Ash2l UTSW 8 25834980 missense probably damaging 0.98
R6678:Ash2l UTSW 8 25833777 missense probably damaging 1.00
R6710:Ash2l UTSW 8 25819712 missense possibly damaging 0.63
R6954:Ash2l UTSW 8 25822768 missense possibly damaging 0.52
R7266:Ash2l UTSW 8 25827205 nonsense probably null
R7483:Ash2l UTSW 8 25822770 missense probably damaging 1.00
R7828:Ash2l UTSW 8 25823186 missense possibly damaging 0.91
R8084:Ash2l UTSW 8 25831294 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAGCCCAATTACTAAATGATCTC -3'
(R):5'- AAGTCTTTGCAGGGCTCAGG -3'

Sequencing Primer
(F):5'- GATCTCATTAAAACTTACACACCTCG -3'
(R):5'- GTGTGTGTTCTACCAGAAACAACAG -3'
Posted On2019-06-26