Incidental Mutation 'R7166:Hlcs'
ID557959
Institutional Source Beutler Lab
Gene Symbol Hlcs
Ensembl Gene ENSMUSG00000040820
Gene Nameholocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
SynonymsD16Jhu34, 410I21.SP6
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7166 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location94128882-94313571 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94262726 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 345 (D345N)
Ref Sequence ENSEMBL: ENSMUSP00000130981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099512] [ENSMUST00000163193] [ENSMUST00000227141]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099512
AA Change: D345N

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097112
Gene: ENSMUSG00000040820
AA Change: D345N

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
Pfam:BPL_LplA_LipB 467 599 1.9e-21 PFAM
Pfam:BPL_C 665 714 3.7e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163193
AA Change: D345N

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130981
Gene: ENSMUSG00000040820
AA Change: D345N

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
Pfam:BPL_LplA_LipB 467 599 3.6e-30 PFAM
Pfam:BPL_C 665 714 4.9e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227141
AA Change: D492N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the binding of biotin to carboxylases and histones. The protein plays an important role in gluconeogenesis, fatty acid synthesis and branched chain amino acid catabolism. Defects in this gene are the cause of holocarboxylase synthetase deficiency. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambn T C 5: 88,467,528 L272P possibly damaging Het
Ash2l C A 8: 25,827,320 G335V probably damaging Het
Atp13a1 T A 8: 69,799,316 probably null Het
Atp13a2 G A 4: 141,006,984 R1139Q possibly damaging Het
Atxn2 T A 5: 121,796,397 N886K possibly damaging Het
Celsr3 G T 9: 108,842,951 C2512F probably damaging Het
Cfap221 A G 1: 119,948,113 V449A probably benign Het
Cfhr2 A T 1: 139,831,101 C70* probably null Het
Chfr C A 5: 110,158,805 P472Q probably benign Het
Crybg2 G A 4: 134,060,882 R22Q probably damaging Het
Eef2k T C 7: 120,884,772 F244L probably damaging Het
Efcab11 A T 12: 99,883,355 M23K Het
Ercc8 T A 13: 108,169,433 M114K possibly damaging Het
Fam217a T C 13: 34,910,315 Y487C probably benign Het
Farsb T C 1: 78,471,184 N205S probably benign Het
Glra1 A G 11: 55,515,078 F370S probably benign Het
Gm12258 T A 11: 58,858,473 M158K Het
Gm14305 T A 2: 176,720,943 H209Q probably damaging Het
Gm4924 A T 10: 82,378,201 Q611L unknown Het
Gm5580 A G 6: 116,551,368 I69V probably benign Het
Haus6 T C 4: 86,583,687 E649G possibly damaging Het
Hist1h4j A G 13: 21,735,151 H19R unknown Het
Htt C A 5: 34,852,894 Q1564K probably benign Het
Itpr1 G A 6: 108,378,190 V481I probably benign Het
Jak3 T C 8: 71,682,316 I531T probably damaging Het
Kng1 T A 16: 23,079,678 H609Q probably benign Het
Mdn1 T A 4: 32,746,446 S4131T probably damaging Het
Npnt A G 3: 132,948,128 S31P probably damaging Het
Olfr1098 T A 2: 86,922,748 K261N probably damaging Het
Olfr1186 A T 2: 88,525,646 Q21L possibly damaging Het
Olfr398 A T 11: 73,984,295 F104L possibly damaging Het
Paxx A T 2: 25,460,226 L123Q probably damaging Het
Prdm13 C T 4: 21,683,528 R144Q unknown Het
Rab2b C A 14: 52,279,345 probably benign Het
Rnf207 A G 4: 152,311,780 I509T probably damaging Het
Ropn1l T C 15: 31,453,509 Q12R Het
Ryr3 T G 2: 112,875,028 Y847S probably damaging Het
Slc1a6 A T 10: 78,812,812 T456S possibly damaging Het
Slc26a2 A T 18: 61,198,829 M510K possibly damaging Het
Slc5a9 T C 4: 111,883,839 T537A probably benign Het
Slc9b2 T C 3: 135,326,178 Y132H unknown Het
Sltm T C 9: 70,584,850 L725S probably damaging Het
Spz1 A G 13: 92,575,927 C14R probably benign Het
Srrm4 T A 5: 116,471,242 Q172L unknown Het
Synj2bp T C 12: 81,504,515 D92G probably benign Het
Tmem169 A C 1: 72,301,070 T220P probably benign Het
Ttn T A 2: 76,888,028 I7270F unknown Het
Txndc16 T G 14: 45,183,154 N137H probably benign Het
Ubr5 A G 15: 37,976,145 Y2499H Het
Ugt2b38 T C 5: 87,410,446 D452G probably damaging Het
Zfp12 T A 5: 143,245,502 I560N possibly damaging Het
Zfp60 A G 7: 27,749,512 K535R possibly damaging Het
Zfp960 T A 17: 17,088,499 C492S probably damaging Het
Other mutations in Hlcs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01078:Hlcs APN 16 94133160 missense probably damaging 0.99
IGL02026:Hlcs APN 16 94134705 missense probably damaging 0.99
IGL02341:Hlcs APN 16 94231110 missense probably damaging 0.99
IGL03075:Hlcs APN 16 94138847 missense probably damaging 1.00
PIT4515001:Hlcs UTSW 16 94267416 missense probably benign 0.45
R0372:Hlcs UTSW 16 94138907 missense possibly damaging 0.69
R0664:Hlcs UTSW 16 94231311 missense probably damaging 1.00
R0731:Hlcs UTSW 16 94131852 missense probably damaging 1.00
R1465:Hlcs UTSW 16 94268292 missense probably damaging 0.99
R1465:Hlcs UTSW 16 94268292 missense probably damaging 0.99
R1761:Hlcs UTSW 16 94268007 missense probably benign 0.05
R2013:Hlcs UTSW 16 94262740 missense probably benign 0.17
R2014:Hlcs UTSW 16 94262740 missense probably benign 0.17
R2015:Hlcs UTSW 16 94262740 missense probably benign 0.17
R2204:Hlcs UTSW 16 94231152 missense probably benign 0.30
R2371:Hlcs UTSW 16 94268067 missense probably damaging 0.98
R3816:Hlcs UTSW 16 94133088 missense probably benign 0.11
R3822:Hlcs UTSW 16 94267981 missense probably benign 0.04
R4422:Hlcs UTSW 16 94138960 missense possibly damaging 0.56
R4657:Hlcs UTSW 16 94262698 missense probably benign 0.00
R4783:Hlcs UTSW 16 94268539 missense possibly damaging 0.82
R5347:Hlcs UTSW 16 94267524 missense possibly damaging 0.93
R5808:Hlcs UTSW 16 94262632 missense probably benign 0.00
R5940:Hlcs UTSW 16 94134712 missense probably damaging 0.99
R6341:Hlcs UTSW 16 94231163 missense probably damaging 1.00
R6943:Hlcs UTSW 16 94141402 missense possibly damaging 0.75
R7053:Hlcs UTSW 16 94268015 missense possibly damaging 0.91
R7157:Hlcs UTSW 16 94268164 nonsense probably null
R7313:Hlcs UTSW 16 94267503 missense probably damaging 1.00
R7427:Hlcs UTSW 16 94267899 missense probably benign 0.00
R7428:Hlcs UTSW 16 94267899 missense probably benign 0.00
R7547:Hlcs UTSW 16 94231172 nonsense probably null
R7548:Hlcs UTSW 16 94133017 nonsense probably null
X0065:Hlcs UTSW 16 94133173 missense probably damaging 1.00
Z1176:Hlcs UTSW 16 94262659 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGTGGTTTTGAGGCACC -3'
(R):5'- CATTGTTTTAAGTGGCCCGTTC -3'

Sequencing Primer
(F):5'- TTTTGAGGCACCCACGG -3'
(R):5'- TAAGTGGCCCGTTCCAGTC -3'
Posted On2019-06-26