Incidental Mutation 'R7167:Dnah7a'
ID557962
Institutional Source Beutler Lab
Gene Symbol Dnah7a
Ensembl Gene ENSMUSG00000096141
Gene Namedynein, axonemal, heavy chain 7A
SynonymsDnahc7a, Dnahc7, LOC381341
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R7167 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location53397006-53706784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 53503776 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 2412 (V2412I)
Ref Sequence ENSEMBL: ENSMUSP00000092571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094964]
Predicted Effect probably benign
Transcript: ENSMUST00000094964
AA Change: V2412I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000092571
Gene: ENSMUSG00000096141
AA Change: V2412I

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
coiled coil region 504 537 N/A INTRINSIC
Pfam:DHC_N2 756 1165 3.1e-149 PFAM
AAA 1320 1459 2.46e-1 SMART
Blast:AAA 1601 1879 1e-87 BLAST
AAA 1968 2116 5.39e-2 SMART
Pfam:AAA_8 2303 2574 6.9e-75 PFAM
Pfam:MT 2586 2936 2.1e-55 PFAM
Pfam:AAA_9 2957 3182 1.3e-98 PFAM
Pfam:Dynein_heavy 3318 4020 2.3e-287 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 94% (65/69)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,647,971 V436A probably benign Het
Abcc5 T C 16: 20,405,501 T111A possibly damaging Het
Acsbg2 T A 17: 56,857,000 D203V probably benign Het
Alpk2 G T 18: 65,306,978 T448K probably benign Het
Arhgef2 A G 3: 88,643,872 N780S possibly damaging Het
Atxn2l T C 7: 126,499,222 N252S possibly damaging Het
Bmpr1b A T 3: 141,863,080 L163Q probably benign Het
Clca2 T C 3: 145,097,784 R100G probably benign Het
Col2a1 A G 15: 98,000,456 I79T unknown Het
Csmd1 A G 8: 15,926,524 V2898A probably benign Het
Cux1 G A 5: 136,310,041 probably null Het
Cyp2u1 A G 3: 131,303,124 S2P probably benign Het
Daam1 C A 12: 71,988,904 H958N probably damaging Het
Ergic2 T C 6: 148,206,635 R2G probably damaging Het
Fam159b A G 13: 104,863,658 V19A probably damaging Het
Fat2 T C 11: 55,285,001 T1629A possibly damaging Het
Ftl1 T A 7: 45,459,778 probably benign Het
Fut8 T C 12: 77,448,632 V332A possibly damaging Het
Gm28363 T C 1: 117,727,389 S113P probably damaging Het
Gm6502 G A 5: 94,317,125 A457T possibly damaging Het
Hfe A T 13: 23,708,069 V104E probably damaging Het
Ifih1 A T 2: 62,598,896 N899K probably benign Het
Krt75 A G 15: 101,568,315 S380P possibly damaging Het
Meiob T G 17: 24,836,445 F409V probably damaging Het
Mkrn2os A T 6: 115,585,513 I163N probably damaging Het
Nanos1 G T 19: 60,756,608 G115W probably damaging Het
Naprt C T 15: 75,892,612 A276T probably damaging Het
Oas1e G T 5: 120,795,422 T26N probably benign Het
Olfr1179 A G 2: 88,402,208 V242A possibly damaging Het
Olfr1279 T C 2: 111,306,448 M81T probably benign Het
Olfr355 T C 2: 36,927,521 I198V probably benign Het
Olfr53 T A 7: 140,652,553 C191* probably null Het
Olfr766-ps1 T G 10: 129,063,272 Q245P probably damaging Het
Olfr792 T C 10: 129,540,738 L67P possibly damaging Het
Olfr967 T C 9: 39,750,569 F61S probably damaging Het
Oog2 T G 4: 144,195,175 D218E probably benign Het
Optn T C 2: 5,042,483 N207S probably benign Het
Oxnad1 G T 14: 32,101,019 E236* probably null Het
Pcdha3 G A 18: 36,946,993 A263T probably damaging Het
Pex13 A T 11: 23,655,472 W253R possibly damaging Het
Pip5k1b T A 19: 24,397,069 E49D probably benign Het
Plau C A 14: 20,839,450 F194L possibly damaging Het
Ppm1n A G 7: 19,279,741 L95S probably damaging Het
Radil G T 5: 142,485,505 probably null Het
Ralgapa2 C T 2: 146,348,454 M1266I probably benign Het
Reln A T 5: 21,942,620 L2444Q probably damaging Het
Rims2 T C 15: 39,437,077 V260A probably benign Het
Rnase2b T A 14: 51,162,765 V101E probably damaging Het
Rtp3 T A 9: 110,986,704 T198S probably benign Het
Smad3 T A 9: 63,666,153 D201V probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Spata7 T G 12: 98,664,296 F371C probably damaging Het
Stag1 T G 9: 100,945,889 N990K probably benign Het
Tbx18 C T 9: 87,707,830 A352T probably damaging Het
Thada C T 17: 84,230,963 R1539Q probably benign Het
Thrap3 A C 4: 126,185,127 probably benign Het
Tnks G A 8: 34,849,304 T887M probably damaging Het
Trap1 A C 16: 4,052,928 V393G probably damaging Het
Trpm4 A G 7: 45,327,719 probably null Het
Trrap G T 5: 144,839,614 G3007C probably benign Het
U2surp A T 9: 95,481,673 N611K probably damaging Het
Usp12 A G 5: 146,768,935 probably null Het
Vmn1r200 A G 13: 22,395,317 T97A possibly damaging Het
Vmn2r110 C T 17: 20,574,179 V743I probably benign Het
Vps50 C T 6: 3,600,256 T905M probably damaging Het
Wdr48 T A 9: 119,907,789 probably null Het
Zfp446 C T 7: 12,978,122 probably benign Het
Zfr T C 15: 12,180,929 S1012P probably benign Het
Other mutations in Dnah7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dnah7a APN 1 53419684 missense probably damaging 0.99
IGL00510:Dnah7a APN 1 53501542 missense probably damaging 1.00
IGL00545:Dnah7a APN 1 53457746 missense possibly damaging 0.87
IGL01320:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01322:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01357:Dnah7a APN 1 53662381 missense probably benign
IGL01417:Dnah7a APN 1 53584600 missense probably benign 0.01
IGL01508:Dnah7a APN 1 53627072 missense probably benign 0.00
IGL01511:Dnah7a APN 1 53419595 missense probably damaging 1.00
IGL01545:Dnah7a APN 1 53518782 missense probably benign
IGL01575:Dnah7a APN 1 53427820 splice site probably benign
IGL01667:Dnah7a APN 1 53547292 missense probably damaging 1.00
IGL01712:Dnah7a APN 1 53423270 missense probably benign 0.23
IGL01824:Dnah7a APN 1 53504270 missense probably benign
IGL01829:Dnah7a APN 1 53618068 missense possibly damaging 0.64
IGL01861:Dnah7a APN 1 53640349 missense probably benign 0.01
IGL01861:Dnah7a APN 1 53584449 splice site probably benign
IGL01984:Dnah7a APN 1 53702015 splice site probably null
IGL02056:Dnah7a APN 1 53504342 missense probably benign 0.17
IGL02069:Dnah7a APN 1 53561894 splice site probably benign
IGL02072:Dnah7a APN 1 53605827 missense probably damaging 1.00
IGL02110:Dnah7a APN 1 53411580 missense possibly damaging 0.52
IGL02120:Dnah7a APN 1 53495717 missense possibly damaging 0.46
IGL02128:Dnah7a APN 1 53437513 missense probably damaging 1.00
IGL02135:Dnah7a APN 1 53623473 missense probably benign 0.01
IGL02151:Dnah7a APN 1 53472864 missense probably benign 0.08
IGL02156:Dnah7a APN 1 53419723 missense probably benign 0.27
IGL02270:Dnah7a APN 1 53472893 missense possibly damaging 0.93
IGL02282:Dnah7a APN 1 53643510 missense possibly damaging 0.93
IGL02328:Dnah7a APN 1 53524937 critical splice donor site probably null
IGL02370:Dnah7a APN 1 53635397 missense probably benign 0.00
IGL02420:Dnah7a APN 1 53686543 missense probably benign
IGL02458:Dnah7a APN 1 53618328 nonsense probably null
IGL02489:Dnah7a APN 1 53647322 missense possibly damaging 0.94
IGL02554:Dnah7a APN 1 53618046 missense possibly damaging 0.93
IGL02578:Dnah7a APN 1 53432915 missense probably benign 0.00
IGL02646:Dnah7a APN 1 53525035 missense probably damaging 0.99
IGL02675:Dnah7a APN 1 53504024 missense possibly damaging 0.96
IGL02688:Dnah7a APN 1 53444472 missense possibly damaging 0.93
IGL02858:Dnah7a APN 1 53472959 splice site probably benign
IGL02874:Dnah7a APN 1 53605814 missense possibly damaging 0.70
IGL02887:Dnah7a APN 1 53522360 missense possibly damaging 0.46
IGL02894:Dnah7a APN 1 53577328 missense probably benign 0.27
IGL02926:Dnah7a APN 1 53495950 missense possibly damaging 0.64
IGL03113:Dnah7a APN 1 53433004 missense possibly damaging 0.64
IGL03156:Dnah7a APN 1 53605824 missense probably damaging 0.97
IGL03195:Dnah7a APN 1 53419607 missense probably damaging 1.00
IGL03209:Dnah7a APN 1 53686614 splice site probably benign
IGL03214:Dnah7a APN 1 53522209 critical splice donor site probably null
IGL03242:Dnah7a APN 1 53620723 missense probably benign 0.02
IGL03251:Dnah7a APN 1 53647274 missense probably benign
IGL03265:Dnah7a APN 1 53528848 missense probably benign
IGL03277:Dnah7a APN 1 53630322 missense probably benign 0.00
IGL03278:Dnah7a APN 1 53496965 missense probably benign 0.07
IGL03356:Dnah7a APN 1 53503934 missense probably benign 0.01
PIT4378001:Dnah7a UTSW 1 53531203 missense probably damaging 0.99
R0046:Dnah7a UTSW 1 53456874 splice site probably null
R0051:Dnah7a UTSW 1 53521086 splice site probably benign
R0082:Dnah7a UTSW 1 53518708 missense probably damaging 1.00
R0111:Dnah7a UTSW 1 53468684 missense probably benign 0.03
R0122:Dnah7a UTSW 1 53397142 missense probably damaging 1.00
R0245:Dnah7a UTSW 1 53501526 missense probably damaging 1.00
R0278:Dnah7a UTSW 1 53504146 missense probably benign 0.00
R0309:Dnah7a UTSW 1 53405690 missense probably damaging 0.97
R0334:Dnah7a UTSW 1 53433054 missense possibly damaging 0.61
R0392:Dnah7a UTSW 1 53504198 missense probably damaging 0.97
R0452:Dnah7a UTSW 1 53605819 missense probably benign 0.00
R0511:Dnah7a UTSW 1 53497126 missense probably benign
R0576:Dnah7a UTSW 1 53636087 missense probably benign 0.12
R0592:Dnah7a UTSW 1 53456612 missense possibly damaging 0.91
R0628:Dnah7a UTSW 1 53497105 missense probably benign 0.18
R0689:Dnah7a UTSW 1 53620681 nonsense probably null
R0735:Dnah7a UTSW 1 53544511 missense possibly damaging 0.70
R0800:Dnah7a UTSW 1 53565696 missense probably damaging 1.00
R0829:Dnah7a UTSW 1 53504079 missense probably benign 0.07
R0842:Dnah7a UTSW 1 53501674 missense possibly damaging 0.88
R0879:Dnah7a UTSW 1 53427860 missense possibly damaging 0.85
R1331:Dnah7a UTSW 1 53468669 missense probably damaging 0.99
R1418:Dnah7a UTSW 1 53647236 splice site probably benign
R1421:Dnah7a UTSW 1 53540873 splice site probably benign
R1445:Dnah7a UTSW 1 53528797 missense probably benign 0.02
R1473:Dnah7a UTSW 1 53496014 missense probably benign 0.00
R1538:Dnah7a UTSW 1 53495989 missense possibly damaging 0.71
R1742:Dnah7a UTSW 1 53456684 missense probably benign 0.39
R1754:Dnah7a UTSW 1 53504185 missense probably benign 0.18
R1754:Dnah7a UTSW 1 53561900 critical splice donor site probably null
R1773:Dnah7a UTSW 1 53432887 splice site probably null
R1779:Dnah7a UTSW 1 53577223 missense probably benign
R1816:Dnah7a UTSW 1 53631742 splice site probably benign
R1817:Dnah7a UTSW 1 53559148 missense probably benign
R1818:Dnah7a UTSW 1 53559148 missense probably benign
R1819:Dnah7a UTSW 1 53559148 missense probably benign
R1873:Dnah7a UTSW 1 53456532 splice site probably benign
R1875:Dnah7a UTSW 1 53456532 splice site probably benign
R1884:Dnah7a UTSW 1 53541000 missense probably damaging 0.99
R1902:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1903:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1908:Dnah7a UTSW 1 53631562 missense probably benign
R1959:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1960:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1985:Dnah7a UTSW 1 53503934 missense probably benign 0.01
R1992:Dnah7a UTSW 1 53582676 missense possibly damaging 0.91
R2037:Dnah7a UTSW 1 53582582 missense probably benign 0.00
R2074:Dnah7a UTSW 1 53457696 missense probably benign 0.45
R2076:Dnah7a UTSW 1 53503809 missense probably benign 0.01
R2124:Dnah7a UTSW 1 53496942 missense possibly damaging 0.58
R2191:Dnah7a UTSW 1 53605875 missense possibly damaging 0.54
R2211:Dnah7a UTSW 1 53479773 missense probably benign 0.21
R2220:Dnah7a UTSW 1 53521174 missense probably benign
R2355:Dnah7a UTSW 1 53582502 missense probably benign 0.00
R2495:Dnah7a UTSW 1 53605881 missense probably damaging 1.00
R2901:Dnah7a UTSW 1 53427872 missense probably damaging 0.99
R2911:Dnah7a UTSW 1 53427824 critical splice donor site probably null
R2993:Dnah7a UTSW 1 53503554 missense probably damaging 1.00
R3522:Dnah7a UTSW 1 53618116 missense probably damaging 1.00
R3683:Dnah7a UTSW 1 53444516 missense probably benign
R3723:Dnah7a UTSW 1 53447346 missense probably benign 0.04
R3847:Dnah7a UTSW 1 53501656 missense probably benign 0.01
R4002:Dnah7a UTSW 1 53631681 missense probably benign
R4009:Dnah7a UTSW 1 53525005 missense probably damaging 1.00
R4063:Dnah7a UTSW 1 53425217 missense probably benign
R4193:Dnah7a UTSW 1 53447334 missense probably benign 0.00
R4236:Dnah7a UTSW 1 53447365 missense probably benign 0.00
R4399:Dnah7a UTSW 1 53518727 missense probably damaging 1.00
R4469:Dnah7a UTSW 1 53444526 missense probably benign 0.01
R4494:Dnah7a UTSW 1 53449038 missense probably benign 0.01
R4569:Dnah7a UTSW 1 53411659 missense probably benign 0.01
R4609:Dnah7a UTSW 1 53456657 missense possibly damaging 0.80
R4632:Dnah7a UTSW 1 53427951 missense probably damaging 0.97
R4703:Dnah7a UTSW 1 53447317 critical splice donor site probably null
R4781:Dnah7a UTSW 1 53425208 missense probably benign 0.28
R4854:Dnah7a UTSW 1 53706729 utr 5 prime probably benign
R4932:Dnah7a UTSW 1 53503578 missense possibly damaging 0.90
R4976:Dnah7a UTSW 1 53698692 missense probably benign
R5000:Dnah7a UTSW 1 53567042 missense probably damaging 1.00
R5023:Dnah7a UTSW 1 53647248 nonsense probably null
R5026:Dnah7a UTSW 1 53662498 missense probably damaging 0.99
R5050:Dnah7a UTSW 1 53497096 missense probably benign 0.01
R5119:Dnah7a UTSW 1 53698692 missense probably benign
R5151:Dnah7a UTSW 1 53620770 missense probably benign 0.00
R5155:Dnah7a UTSW 1 53643495 missense probably benign 0.01
R5180:Dnah7a UTSW 1 53423287 missense probably damaging 0.97
R5228:Dnah7a UTSW 1 53437609 critical splice acceptor site probably null
R5237:Dnah7a UTSW 1 53447531 intron probably null
R5267:Dnah7a UTSW 1 53479692 missense probably damaging 1.00
R5334:Dnah7a UTSW 1 53503646 missense probably benign 0.00
R5358:Dnah7a UTSW 1 53547172 missense probably damaging 1.00
R5401:Dnah7a UTSW 1 53631653 missense probably benign 0.01
R5412:Dnah7a UTSW 1 53635344 missense probably benign
R5496:Dnah7a UTSW 1 53457768 missense probably benign
R5531:Dnah7a UTSW 1 53419748 missense possibly damaging 0.50
R5536:Dnah7a UTSW 1 53425253 missense probably benign
R5543:Dnah7a UTSW 1 53504069 missense probably damaging 1.00
R5597:Dnah7a UTSW 1 53534452 missense probably benign 0.00
R5609:Dnah7a UTSW 1 53582594 missense probably benign 0.03
R5643:Dnah7a UTSW 1 53405707 missense probably benign
R5644:Dnah7a UTSW 1 53540979 missense probably benign 0.33
R5689:Dnah7a UTSW 1 53405698 missense possibly damaging 0.87
R5715:Dnah7a UTSW 1 53413778 missense probably damaging 1.00
R5780:Dnah7a UTSW 1 53483319 missense probably benign 0.03
R5893:Dnah7a UTSW 1 53457785 missense possibly damaging 0.66
R5946:Dnah7a UTSW 1 53559308 missense probably damaging 1.00
R5995:Dnah7a UTSW 1 53620670 missense probably benign 0.00
R6102:Dnah7a UTSW 1 53559140 missense probably benign 0.00
R6108:Dnah7a UTSW 1 53456845 missense probably damaging 1.00
R6133:Dnah7a UTSW 1 53419655 missense probably benign 0.05
R6168:Dnah7a UTSW 1 53411568 missense probably damaging 1.00
R6175:Dnah7a UTSW 1 53433022 missense probably damaging 1.00
R6211:Dnah7a UTSW 1 53419636 missense probably damaging 0.99
R6282:Dnah7a UTSW 1 53503601 missense probably damaging 1.00
R6329:Dnah7a UTSW 1 53541114 missense probably damaging 1.00
R6344:Dnah7a UTSW 1 53397190 missense probably benign 0.02
R6530:Dnah7a UTSW 1 53503697 missense probably benign 0.04
R6574:Dnah7a UTSW 1 53456534 critical splice donor site probably null
R6608:Dnah7a UTSW 1 53525118 missense probably benign
R6625:Dnah7a UTSW 1 53565757 missense probably benign 0.05
R6661:Dnah7a UTSW 1 53623450 missense probably benign 0.00
R6681:Dnah7a UTSW 1 53521226 critical splice acceptor site probably null
R6747:Dnah7a UTSW 1 53636062 missense probably benign 0.01
R6774:Dnah7a UTSW 1 53698651 missense probably benign
R6823:Dnah7a UTSW 1 53456704 missense probably benign
R6900:Dnah7a UTSW 1 53662351 missense probably damaging 0.97
R6940:Dnah7a UTSW 1 53631677 missense probably benign 0.09
R6956:Dnah7a UTSW 1 53577287 missense probably benign 0.02
R6978:Dnah7a UTSW 1 53662367 missense probably null
R6988:Dnah7a UTSW 1 53582625 missense possibly damaging 0.62
R7026:Dnah7a UTSW 1 53504289 missense probably benign
R7027:Dnah7a UTSW 1 53631506 missense probably benign 0.01
R7033:Dnah7a UTSW 1 53479661 missense probably damaging 1.00
R7072:Dnah7a UTSW 1 53419753 missense probably benign 0.00
R7096:Dnah7a UTSW 1 53483440 missense possibly damaging 0.90
R7142:Dnah7a UTSW 1 53413768 nonsense probably null
R7144:Dnah7a UTSW 1 53698708 splice site probably null
R7182:Dnah7a UTSW 1 53620461 intron probably null
R7196:Dnah7a UTSW 1 53684841 missense probably benign 0.00
R7206:Dnah7a UTSW 1 53698633 nonsense probably null
R7215:Dnah7a UTSW 1 53618350 missense probably damaging 0.99
R7224:Dnah7a UTSW 1 53397261 missense probably benign 0.00
R7264:Dnah7a UTSW 1 53518814 missense probably benign
R7282:Dnah7a UTSW 1 53684900 critical splice acceptor site probably null
R7365:Dnah7a UTSW 1 53497138 missense probably benign
R7392:Dnah7a UTSW 1 53501661 missense probably benign 0.00
R7454:Dnah7a UTSW 1 53518764 missense probably benign
R7471:Dnah7a UTSW 1 53419699 missense probably damaging 1.00
R7547:Dnah7a UTSW 1 53663837 missense probably benign 0.00
R7554:Dnah7a UTSW 1 53528698 missense possibly damaging 0.87
R7655:Dnah7a UTSW 1 53496005 missense possibly damaging 0.50
R7656:Dnah7a UTSW 1 53496005 missense possibly damaging 0.50
R7666:Dnah7a UTSW 1 53547297 missense probably benign 0.00
R7721:Dnah7a UTSW 1 53631683 missense probably benign
X0027:Dnah7a UTSW 1 53472930 missense probably damaging 1.00
Z1088:Dnah7a UTSW 1 53468643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCGAAGACGAATCCGAAATG -3'
(R):5'- GCGCACATGGCTGATTATTC -3'

Sequencing Primer
(F):5'- GAAATGCGTCTCCAATGGGACTC -3'
(R):5'- ATGGCTGATTATTCACTTTTCCAGG -3'
Posted On2019-06-26