Mutagenetix > Incidental Mutation

Incidental Mutation 'R7167:Reln'

557974

Institutional Source

Beutler Lab

Gene Symbol

Reln

Ensembl Gene

ENSMUSG00000042453

Gene Name

reelin

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R7167 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21884454-22344702 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 21942620 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 2444 (L2444Q)

Ref Sequence

ENSEMBL: ENSMUSP00000124052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000062372
AA Change: L2444Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: L2444Q

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	40	172	6.1e-24	PFAM
internal_repeat_3	195	360	5.04e-6	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3450	3457	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000161356
AA Change: L2444Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: L2444Q

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	54	171	2.9e-10	PFAM
internal_repeat_3	195	360	5.06e-6	PROSPERO
internal_repeat_2	207	413	3.41e-11	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
internal_repeat_2	1452	1660	3.41e-11	PROSPERO
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3452	3459	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

94% (65/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	C	6: 121,647,971	V436A	probably benign	Het
Abcc5	T	C	16: 20,405,501	T111A	possibly damaging	Het
Acsbg2	T	A	17: 56,857,000	D203V	probably benign	Het
Alpk2	G	T	18: 65,306,978	T448K	probably benign	Het
Arhgef2	A	G	3: 88,643,872	N780S	possibly damaging	Het
Atxn2l	T	C	7: 126,499,222	N252S	possibly damaging	Het
Bmpr1b	A	T	3: 141,863,080	L163Q	probably benign	Het
Clca2	T	C	3: 145,097,784	R100G	probably benign	Het
Col2a1	A	G	15: 98,000,456	I79T	unknown	Het
Csmd1	A	G	8: 15,926,524	V2898A	probably benign	Het
Cux1	G	A	5: 136,310,041		probably null	Het
Cyp2u1	A	G	3: 131,303,124	S2P	probably benign	Het
Daam1	C	A	12: 71,988,904	H958N	probably damaging	Het
Dnah7a	C	T	1: 53,503,776	V2412I	probably benign	Het
Ergic2	T	C	6: 148,206,635	R2G	probably damaging	Het
Fam159b	A	G	13: 104,863,658	V19A	probably damaging	Het
Fat2	T	C	11: 55,285,001	T1629A	possibly damaging	Het
Ftl1	T	A	7: 45,459,778		probably benign	Het
Fut8	T	C	12: 77,448,632	V332A	possibly damaging	Het
Gm28363	T	C	1: 117,727,389	S113P	probably damaging	Het
Gm6502	G	A	5: 94,317,125	A457T	possibly damaging	Het
Hfe	A	T	13: 23,708,069	V104E	probably damaging	Het
Ifih1	A	T	2: 62,598,896	N899K	probably benign	Het
Krt75	A	G	15: 101,568,315	S380P	possibly damaging	Het
Meiob	T	G	17: 24,836,445	F409V	probably damaging	Het
Mkrn2os	A	T	6: 115,585,513	I163N	probably damaging	Het
Nanos1	G	T	19: 60,756,608	G115W	probably damaging	Het
Naprt	C	T	15: 75,892,612	A276T	probably damaging	Het
Oas1e	G	T	5: 120,795,422	T26N	probably benign	Het
Olfr1179	A	G	2: 88,402,208	V242A	possibly damaging	Het
Olfr1279	T	C	2: 111,306,448	M81T	probably benign	Het
Olfr355	T	C	2: 36,927,521	I198V	probably benign	Het
Olfr53	T	A	7: 140,652,553	C191*	probably null	Het
Olfr766-ps1	T	G	10: 129,063,272	Q245P	probably damaging	Het
Olfr792	T	C	10: 129,540,738	L67P	possibly damaging	Het
Olfr967	T	C	9: 39,750,569	F61S	probably damaging	Het
Oog2	T	G	4: 144,195,175	D218E	probably benign	Het
Optn	T	C	2: 5,042,483	N207S	probably benign	Het
Oxnad1	G	T	14: 32,101,019	E236*	probably null	Het
Pcdha3	G	A	18: 36,946,993	A263T	probably damaging	Het
Pex13	A	T	11: 23,655,472	W253R	possibly damaging	Het
Pip5k1b	T	A	19: 24,397,069	E49D	probably benign	Het
Plau	C	A	14: 20,839,450	F194L	possibly damaging	Het
Ppm1n	A	G	7: 19,279,741	L95S	probably damaging	Het
Radil	G	T	5: 142,485,505		probably null	Het
Ralgapa2	C	T	2: 146,348,454	M1266I	probably benign	Het
Rims2	T	C	15: 39,437,077	V260A	probably benign	Het
Rnase2b	T	A	14: 51,162,765	V101E	probably damaging	Het
Rtp3	T	A	9: 110,986,704	T198S	probably benign	Het
Smad3	T	A	9: 63,666,153	D201V	probably benign	Het
Son	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	16: 91,660,334		probably benign	Het
Spata7	T	G	12: 98,664,296	F371C	probably damaging	Het
Stag1	T	G	9: 100,945,889	N990K	probably benign	Het
Tbx18	C	T	9: 87,707,830	A352T	probably damaging	Het
Thada	C	T	17: 84,230,963	R1539Q	probably benign	Het
Thrap3	A	C	4: 126,185,127		probably benign	Het
Tnks	G	A	8: 34,849,304	T887M	probably damaging	Het
Trap1	A	C	16: 4,052,928	V393G	probably damaging	Het
Trpm4	A	G	7: 45,327,719		probably null	Het
Trrap	G	T	5: 144,839,614	G3007C	probably benign	Het
U2surp	A	T	9: 95,481,673	N611K	probably damaging	Het
Usp12	A	G	5: 146,768,935		probably null	Het
Vmn1r200	A	G	13: 22,395,317	T97A	possibly damaging	Het
Vmn2r110	C	T	17: 20,574,179	V743I	probably benign	Het
Vps50	C	T	6: 3,600,256	T905M	probably damaging	Het
Wdr48	T	A	9: 119,907,789		probably null	Het
Zfp446	C	T	7: 12,978,122		probably benign	Het
Zfr	T	C	15: 12,180,929	S1012P	probably benign	Het

Other mutations in Reln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL00091:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL00432:Reln	APN	5	22010127	missense	probably damaging	1.00
IGL00433:Reln	APN	5	22045009	missense	probably damaging	1.00
IGL00576:Reln	APN	5	22154950	missense	probably benign	0.01
IGL00755:Reln	APN	5	22060380	missense	probably damaging	0.98
IGL00777:Reln	APN	5	22018850	critical splice donor site	probably null
IGL00900:Reln	APN	5	21980117	missense	probably damaging	0.98
IGL01067:Reln	APN	5	21979666	missense	probably damaging	1.00
IGL01104:Reln	APN	5	21986967	missense	probably damaging	0.99
IGL01141:Reln	APN	5	21969033	missense	probably damaging	1.00
IGL01141:Reln	APN	5	21919069	missense	probably damaging	1.00
IGL01333:Reln	APN	5	22171251	missense	probably damaging	0.99
IGL01341:Reln	APN	5	21969079	missense	probably damaging	1.00
IGL01354:Reln	APN	5	21919175	nonsense	probably null
IGL01361:Reln	APN	5	21919021	missense	probably benign	0.06
IGL01446:Reln	APN	5	21969317	missense	probably damaging	0.99
IGL01448:Reln	APN	5	22040405	missense	probably benign	0.40
IGL01612:Reln	APN	5	21896930	missense	probably damaging	0.99
IGL01695:Reln	APN	5	21920438	missense	probably damaging	1.00
IGL01718:Reln	APN	5	21947514	missense	possibly damaging	0.60
IGL01749:Reln	APN	5	22344246	nonsense	probably null
IGL01875:Reln	APN	5	21904717	missense	probably benign
IGL02013:Reln	APN	5	21950879	missense	probably damaging	1.00
IGL02031:Reln	APN	5	21979016	missense	probably damaging	0.99
IGL02186:Reln	APN	5	21909958	missense	probably damaging	1.00
IGL02228:Reln	APN	5	21904731	missense	probably damaging	0.99
IGL02248:Reln	APN	5	21910992	missense	probably damaging	1.00
IGL02336:Reln	APN	5	21929134	missense	probably damaging	1.00
IGL02352:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL02359:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL02376:Reln	APN	5	22080791	nonsense	probably null
IGL02408:Reln	APN	5	21901619	missense	probably benign	0.44
IGL02415:Reln	APN	5	21971951	missense	possibly damaging	0.91
IGL02512:Reln	APN	5	22040427	missense	probably benign	0.00
IGL02540:Reln	APN	5	22034752	missense	probably damaging	0.96
IGL02624:Reln	APN	5	22103357	missense	probably benign	0.09
IGL02720:Reln	APN	5	21997941	missense	probably damaging	0.99
IGL02894:Reln	APN	5	21885548	missense	possibly damaging	0.72
IGL02999:Reln	APN	5	21995365	missense	probably damaging	1.00
IGL03125:Reln	APN	5	21910844	missense	probably damaging	1.00
IGL03298:Reln	APN	5	21910836	missense	probably damaging	0.99
Fishing	UTSW	5	21896841	missense	probably damaging	1.00
P0020:Reln	UTSW	5	22106060	missense	possibly damaging	0.91
PIT4151001:Reln	UTSW	5	22286896	missense	possibly damaging	0.71
R0018:Reln	UTSW	5	21925371	missense	probably benign	0.01
R0105:Reln	UTSW	5	22048815	missense	probably damaging	0.99
R0105:Reln	UTSW	5	22048815	missense	probably damaging	0.99
R0127:Reln	UTSW	5	22004136	missense	probably damaging	1.00
R0135:Reln	UTSW	5	22128649	missense	probably damaging	0.99
R0144:Reln	UTSW	5	21948449	missense	probably damaging	0.97
R0240:Reln	UTSW	5	22106045	missense	probably benign	0.36
R0240:Reln	UTSW	5	22106045	missense	probably benign	0.36
R0242:Reln	UTSW	5	21942597	critical splice donor site	probably null
R0242:Reln	UTSW	5	21942597	critical splice donor site	probably null
R0266:Reln	UTSW	5	21988776	missense	probably damaging	1.00
R0269:Reln	UTSW	5	21920537	missense	probably damaging	1.00
R0280:Reln	UTSW	5	22227513	splice site	probably benign
R0333:Reln	UTSW	5	21929242	missense	probably damaging	0.97
R0357:Reln	UTSW	5	21950822	missense	probably damaging	1.00
R0359:Reln	UTSW	5	22048800	missense	probably damaging	0.98
R0506:Reln	UTSW	5	21920496	missense	probably damaging	0.97
R0534:Reln	UTSW	5	21947408	missense	probably damaging	0.99
R0535:Reln	UTSW	5	22051276	splice site	probably benign
R0541:Reln	UTSW	5	21980109	missense	possibly damaging	0.88
R0615:Reln	UTSW	5	22010150	missense	probably benign	0.36
R0617:Reln	UTSW	5	21920537	missense	probably damaging	1.00
R0634:Reln	UTSW	5	22018869	missense	probably damaging	1.00
R0653:Reln	UTSW	5	21913230	missense	probably benign	0.44
R0704:Reln	UTSW	5	21896811	missense	probably damaging	0.99
R0706:Reln	UTSW	5	21896811	missense	probably damaging	0.99
R0959:Reln	UTSW	5	22227628	missense	probably damaging	0.96
R1066:Reln	UTSW	5	22034664	missense	probably damaging	1.00
R1110:Reln	UTSW	5	22034775	missense	probably benign
R1163:Reln	UTSW	5	21899029	missense	probably benign	0.03
R1222:Reln	UTSW	5	21986955	missense	probably null	0.97
R1226:Reln	UTSW	5	21910866	missense	probably damaging	1.00
R1440:Reln	UTSW	5	22128602	splice site	probably benign
R1532:Reln	UTSW	5	22034744	missense	probably damaging	0.99
R1552:Reln	UTSW	5	21960378	missense	probably benign	0.01
R1565:Reln	UTSW	5	21925213	missense	probably benign	0.05
R1618:Reln	UTSW	5	22060368	missense	probably benign	0.01
R1636:Reln	UTSW	5	21998683	missense	probably damaging	0.99
R1664:Reln	UTSW	5	21929086	missense	probably damaging	1.00
R1716:Reln	UTSW	5	21955095	missense	probably damaging	0.98
R1759:Reln	UTSW	5	22010289	missense	probably damaging	0.99
R1835:Reln	UTSW	5	21979002	missense	probably damaging	1.00
R1907:Reln	UTSW	5	22044962	critical splice donor site	probably null
R1991:Reln	UTSW	5	21969360	missense	possibly damaging	0.56
R2046:Reln	UTSW	5	21942627	missense	probably benign	0.01
R2072:Reln	UTSW	5	21919177	missense	probably damaging	1.00
R2103:Reln	UTSW	5	21969360	missense	possibly damaging	0.56
R2119:Reln	UTSW	5	22019000	missense	probably damaging	1.00
R2120:Reln	UTSW	5	21969085	missense	probably damaging	1.00
R2216:Reln	UTSW	5	22048005	missense	probably benign	0.30
R2219:Reln	UTSW	5	21972047	missense	possibly damaging	0.88
R2228:Reln	UTSW	5	21987078	missense	possibly damaging	0.69
R2306:Reln	UTSW	5	21896786	missense	probably damaging	1.00
R2316:Reln	UTSW	5	22154956	missense	probably benign	0.00
R2321:Reln	UTSW	5	21915020	missense	probably damaging	0.99
R2512:Reln	UTSW	5	21979690	missense	possibly damaging	0.89
R2519:Reln	UTSW	5	22344369	missense	unknown
R2870:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2870:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R3195:Reln	UTSW	5	22040420	missense	possibly damaging	0.72
R3545:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3546:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3547:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3706:Reln	UTSW	5	21995589	splice site	probably benign
R3713:Reln	UTSW	5	21904734	missense	probably damaging	0.99
R3770:Reln	UTSW	5	21948566	missense	probably damaging	1.00
R3836:Reln	UTSW	5	21911014	missense	probably damaging	1.00
R3887:Reln	UTSW	5	21910849	missense	possibly damaging	0.92
R3972:Reln	UTSW	5	21979001	missense	probably damaging	0.99
R3975:Reln	UTSW	5	21995366	missense	possibly damaging	0.57
R4022:Reln	UTSW	5	22227630	missense	probably benign	0.45
R4044:Reln	UTSW	5	22128632	missense	possibly damaging	0.82
R4107:Reln	UTSW	5	22034584	missense	probably damaging	1.00
R4297:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4298:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4299:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4518:Reln	UTSW	5	21901743	missense	probably benign	0.44
R4615:Reln	UTSW	5	21972872	missense	possibly damaging	0.95
R4713:Reln	UTSW	5	22152463	missense	probably benign	0.17
R4720:Reln	UTSW	5	22286896	missense	possibly damaging	0.71
R4721:Reln	UTSW	5	21919222	missense	probably damaging	0.99
R4771:Reln	UTSW	5	22049700	missense	probably damaging	1.00
R4794:Reln	UTSW	5	22344185	missense	probably damaging	0.98
R4840:Reln	UTSW	5	22018846	splice site	probably null
R4860:Reln	UTSW	5	21901751	missense	probably benign	0.06
R4860:Reln	UTSW	5	21901751	missense	probably benign	0.06
R4896:Reln	UTSW	5	21955238	missense	probably damaging	1.00
R4908:Reln	UTSW	5	21979720	missense	probably benign	0.02
R4912:Reln	UTSW	5	21925193	missense	probably benign	0.29
R4922:Reln	UTSW	5	21995587	critical splice acceptor site	probably null
R4975:Reln	UTSW	5	21960426	missense	probably damaging	1.00
R4976:Reln	UTSW	5	21971870	missense	probably benign	0.05
R5020:Reln	UTSW	5	22034638	missense	probably damaging	1.00
R5037:Reln	UTSW	5	21948512	missense	probably damaging	1.00
R5082:Reln	UTSW	5	21896077	missense	probably benign	0.00
R5119:Reln	UTSW	5	21971870	missense	probably benign	0.05
R5125:Reln	UTSW	5	21913241	missense	possibly damaging	0.78
R5137:Reln	UTSW	5	21955181	missense	probably damaging	1.00
R5152:Reln	UTSW	5	21948629	missense	probably damaging	1.00
R5154:Reln	UTSW	5	21988765	missense	probably damaging	0.99
R5259:Reln	UTSW	5	22103397	missense	possibly damaging	0.83
R5283:Reln	UTSW	5	22011163	missense	probably damaging	1.00
R5386:Reln	UTSW	5	22039529	missense	probably benign
R5400:Reln	UTSW	5	21979714	missense	probably damaging	1.00
R5478:Reln	UTSW	5	22004203	missense	probably benign	0.00
R5514:Reln	UTSW	5	21971885	missense	possibly damaging	0.93
R5529:Reln	UTSW	5	21932715	missense	possibly damaging	0.71
R5611:Reln	UTSW	5	22039665	nonsense	probably null
R5648:Reln	UTSW	5	21998572	missense	probably benign	0.04
R5649:Reln	UTSW	5	21901625	missense	probably benign	0.33
R5744:Reln	UTSW	5	22106083	missense	probably null	0.39
R5782:Reln	UTSW	5	22018056	missense	probably benign	0.01
R5815:Reln	UTSW	5	21947433	missense	probably damaging	0.99
R5838:Reln	UTSW	5	21899113	missense	probably damaging	0.97
R6162:Reln	UTSW	5	21911050	missense	probably damaging	1.00
R6219:Reln	UTSW	5	21948596	missense	probably damaging	1.00
R6259:Reln	UTSW	5	22060333	missense	probably damaging	0.99
R6279:Reln	UTSW	5	21896841	missense	probably damaging	1.00
R6299:Reln	UTSW	5	22286944	missense	possibly damaging	0.71
R6300:Reln	UTSW	5	21896841	missense	probably damaging	1.00
R6314:Reln	UTSW	5	22152484	nonsense	probably null
R6351:Reln	UTSW	5	21901663	nonsense	probably null
R6369:Reln	UTSW	5	22051361	missense	probably benign	0.03
R6371:Reln	UTSW	5	21995513	missense	probably benign
R6374:Reln	UTSW	5	22080714	missense	probably benign	0.06
R6425:Reln	UTSW	5	21911020	nonsense	probably null
R6442:Reln	UTSW	5	21932776	missense	probably benign
R6445:Reln	UTSW	5	21919214	missense	probably benign	0.05
R6554:Reln	UTSW	5	21896840	missense	probably damaging	1.00
R6641:Reln	UTSW	5	21929134	missense	probably damaging	1.00
R6768:Reln	UTSW	5	21978907	missense	probably damaging	0.99
R6859:Reln	UTSW	5	22034570	missense	probably damaging	1.00
R6896:Reln	UTSW	5	21899179	missense	probably benign	0.18
R6932:Reln	UTSW	5	21985857	missense	probably benign	0.00
R6948:Reln	UTSW	5	21972035	missense	probably damaging	1.00
R6959:Reln	UTSW	5	21976564	missense	probably damaging	1.00
R7085:Reln	UTSW	5	21915087	nonsense	probably null
R7091:Reln	UTSW	5	21899029	missense	probably null	0.08
R7135:Reln	UTSW	5	21976596	missense	possibly damaging	0.95
R7146:Reln	UTSW	5	22106097	missense	probably damaging	0.97
R7190:Reln	UTSW	5	22047947	missense	probably damaging	1.00
R7256:Reln	UTSW	5	21978923	missense	probably benign	0.03
R7393:Reln	UTSW	5	21976351	missense	probably damaging	0.99
R7399:Reln	UTSW	5	22051367	missense	probably damaging	0.99
R7400:Reln	UTSW	5	21971934	missense	probably damaging	0.99
R7426:Reln	UTSW	5	21971953	missense	probably damaging	1.00
R7463:Reln	UTSW	5	22103435	missense	probably damaging	0.98
R7470:Reln	UTSW	5	21942741	missense	probably damaging	0.99
R7473:Reln	UTSW	5	21929127	missense	probably benign	0.25
R7501:Reln	UTSW	5	22227638	missense	possibly damaging	0.91
R7542:Reln	UTSW	5	21955181	missense	probably damaging	1.00
R7544:Reln	UTSW	5	21976278	nonsense	probably null
R7588:Reln	UTSW	5	21885568	missense	probably benign	0.03
R7631:Reln	UTSW	5	21971935	missense	probably damaging	0.97
R7644:Reln	UTSW	5	21978931	missense	probably benign	0.39
R7834:Reln	UTSW	5	22039635	missense	possibly damaging	0.94
R7923:Reln	UTSW	5	22134692	missense	probably benign	0.00
R7938:Reln	UTSW	5	21950872	missense	probably damaging	0.97
R8006:Reln	UTSW	5	21899084	nonsense	probably null
R8062:Reln	UTSW	5	21971992	missense	probably benign	0.00
R8222:Reln	UTSW	5	21931477	nonsense	probably null
R8266:Reln	UTSW	5	22018087	missense	possibly damaging	0.62
R8267:Reln	UTSW	5	22004112	missense	probably damaging	1.00
R8487:Reln	UTSW	5	21899029	missense	probably benign	0.03
R8523:Reln	UTSW	5	22004231	missense	probably damaging	1.00
R8751:Reln	UTSW	5	21942674	missense	probably benign	0.37
R8801:Reln	UTSW	5	21950856	missense	possibly damaging	0.94
R8802:Reln	UTSW	5	21925259	missense	probably damaging	0.98
R8978:Reln	UTSW	5	21885514	missense	possibly damaging	0.85
R8988:Reln	UTSW	5	21899157	missense	probably damaging	0.97
R8995:Reln	UTSW	5	21979579	missense	probably benign	0.00
R9022:Reln	UTSW	5	21976615	missense	possibly damaging	0.66
R9042:Reln	UTSW	5	22048038	missense	probably damaging	1.00
R9069:Reln	UTSW	5	22011061	missense	probably damaging	1.00
R9089:Reln	UTSW	5	21925200	missense	probably benign	0.01
R9126:Reln	UTSW	5	21955196	missense	probably damaging	1.00
R9172:Reln	UTSW	5	21950817	critical splice donor site	probably null
R9182:Reln	UTSW	5	21901619	missense	probably benign	0.44
R9196:Reln	UTSW	5	22152473	missense	probably damaging	1.00
R9211:Reln	UTSW	5	22344202	nonsense	probably null
R9241:Reln	UTSW	5	21969069	missense	probably damaging	0.99
R9244:Reln	UTSW	5	21915153	missense	probably damaging	0.99
R9281:Reln	UTSW	5	21948547	missense	probably damaging	1.00
R9295:Reln	UTSW	5	22004211	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	21988707	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	22080691	missense	probably benign	0.01
R9309:Reln	UTSW	5	21971868	missense	probably benign	0.37
R9338:Reln	UTSW	5	21997939	missense	probably damaging	0.98
R9381:Reln	UTSW	5	22344204	missense	possibly damaging	0.93
R9430:Reln	UTSW	5	21915107	missense	probably damaging	1.00
R9509:Reln	UTSW	5	22344200	missense	possibly damaging	0.93
R9515:Reln	UTSW	5	21920510	missense	possibly damaging	0.46
Z1176:Reln	UTSW	5	21979024	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	21969241	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22004082	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22154959	missense	probably benign	0.05
Z1177:Reln	UTSW	5	22227636	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGGTCAGTGTTTTCTTCTATAAGCC -3'
(R):5'- CTGCAGGCATGTACTTATACTGAG -3'

Sequencing Primer
(F):5'- AGTCAGGGAAATCCTAGGTTTAG -3'
(R):5'- GGCATGTACTTATACTGAGAATTCC -3'

Posted On

2019-06-26