Mutagenetix > Incidental Mutation

Incidental Mutation 'R0587:Syt6'

55799

Institutional Source

Beutler Lab

Gene Symbol

Syt6

Ensembl Gene

ENSMUSG00000027849

Gene Name

synaptotagmin VI

Synonyms

3110037A08Rik

MMRRC Submission

038777-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.109) question?

Stock #

R0587 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103575231-103645569 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103625571 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 424 (T424A)

Ref Sequence

ENSEMBL: ENSMUSP00000112997 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090697] [ENSMUST00000117221] [ENSMUST00000118117] [ENSMUST00000118563] [ENSMUST00000121834] [ENSMUST00000132325] [ENSMUST00000136049] [ENSMUST00000151985]

AlphaFold

Q9R0N8

Predicted Effect

probably damaging
Transcript: ENSMUST00000090697
AA Change: T424A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000088196
Gene: ENSMUSG00000027849
AA Change: T424A

Domain	Start	End	E-Value	Type
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	93	103	N/A	INTRINSIC
C2	246	350	2.65e-20	SMART
C2	378	492	2.25e-23	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000117221
AA Change: T339A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000113373
Gene: ENSMUSG00000027849
AA Change: T339A

Domain	Start	End	E-Value	Type
low complexity region	8	18	N/A	INTRINSIC
C2	161	265	2.65e-20	SMART
C2	293	407	2.25e-23	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000118117
AA Change: T339A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000112486
Gene: ENSMUSG00000027849
AA Change: T339A

Domain	Start	End	E-Value	Type
low complexity region	8	18	N/A	INTRINSIC
C2	161	265	2.65e-20	SMART
C2	293	407	2.25e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000118563

SMART Domains

Protein: ENSMUSP00000113287
Gene: ENSMUSG00000027849

Domain	Start	End	E-Value	Type
low complexity region	8	18	N/A	INTRINSIC
C2	161	265	2.65e-20	SMART
Pfam:C2	294	332	3.5e-2	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000121834
AA Change: T424A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112997
Gene: ENSMUSG00000027849
AA Change: T424A

Domain	Start	End	E-Value	Type
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	93	103	N/A	INTRINSIC
C2	246	350	2.65e-20	SMART
C2	378	492	2.25e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132325

SMART Domains

Protein: ENSMUSP00000116324
Gene: ENSMUSG00000027849

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136049

SMART Domains

Protein: ENSMUSP00000118124
Gene: ENSMUSG00000027849

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000151985

Meta Mutation Damage Score

0.4334

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.3%

Validation Efficiency

94% (34/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the synaptotagmin family. Synaptotagmins share a common domain structure that includes a transmembrane domain and a cytoplasmic region composed of 2 C2 domains, and are involved in calcium-dependent exocytosis of synaptic vesicles. This protein has been shown to be a key component of the secretory machinery involved in acrosomal exocytosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061I04Rik	T	C	17: 35,892,963	*212W	probably null	Het
Abca1	A	G	4: 53,107,035	Y231H	probably benign	Het
Abca5	T	G	11: 110,311,377	I401L	probably benign	Het
Ak2	A	G	4: 129,002,378	D112G	probably damaging	Het
Ankrd60	T	A	2: 173,568,851	D292V	possibly damaging	Het
Bank1	A	G	3: 136,214,037		probably benign	Het
Bod1l	G	A	5: 41,821,637	S778L	probably benign	Het
Cep76	C	A	18: 67,623,175	E529*	probably null	Het
Col24a1	T	C	3: 145,293,145	V13A	possibly damaging	Het
Ctsc	T	A	7: 88,297,229	H154Q	probably benign	Het
Ctsf	A	G	19: 4,855,738	E87G	probably benign	Het
Dmxl1	A	T	18: 49,935,307	T2716S	probably benign	Het
Espl1	A	G	15: 102,303,947		probably benign	Het
Fuk	T	A	8: 110,883,325	Q1019L	probably damaging	Het
Hnrnpul1	T	A	7: 25,745,232	Y217F	possibly damaging	Het
Kmt2a	A	T	9: 44,847,534	M1039K	probably damaging	Het
Large1	T	C	8: 72,859,333	N382D	probably damaging	Het
Madd	A	G	2: 91,146,885	V1402A	probably damaging	Het
Mlh3	C	T	12: 85,266,419	V998M	probably benign	Het
Myo1c	A	G	11: 75,657,790	Y71C	probably damaging	Het
Myt1l	G	A	12: 29,811,635	D139N	unknown	Het
Nes	C	A	3: 87,978,569	H1378Q	probably benign	Het
Olfr1259	T	C	2: 89,943,392	H241R	probably damaging	Het
Otud6b	T	C	4: 14,815,661	E243G	probably benign	Het
Pak3	TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	X: 143,743,893		probably benign	Het
Pcm1	G	T	8: 41,286,051	R912L	probably damaging	Het
Piezo2	A	G	18: 63,022,426	I2449T	possibly damaging	Het
Slc12a5	G	A	2: 164,976,533	M217I	probably damaging	Het
Sorl1	C	A	9: 41,984,506	W1784C	probably damaging	Het
Spatc1l	A	G	10: 76,564,177	R178G	possibly damaging	Het
Strada	A	C	11: 106,170,964	Y154D	probably damaging	Het
Tbx1	C	T	16: 18,583,493	A245T	possibly damaging	Het
Tmem143	T	C	7: 45,907,054	L161P	probably damaging	Het

Other mutations in Syt6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Syt6	APN	3	103625626	missense	probably damaging	0.98
IGL02944:Syt6	APN	3	103575549	unclassified	probably benign
IGL03168:Syt6	APN	3	103587627	missense	probably damaging	1.00
PIT4305001:Syt6	UTSW	3	103575453	missense	possibly damaging	0.91
R0124:Syt6	UTSW	3	103587526	missense	probably damaging	1.00
R0601:Syt6	UTSW	3	103620890	missense	probably damaging	1.00
R1262:Syt6	UTSW	3	103585340	critical splice acceptor site	probably null
R1970:Syt6	UTSW	3	103587420	missense	probably benign	0.21
R4012:Syt6	UTSW	3	103625493	splice site	probably benign
R4450:Syt6	UTSW	3	103585645	missense	probably benign	0.01
R4493:Syt6	UTSW	3	103585630	missense	probably damaging	0.99
R4494:Syt6	UTSW	3	103585630	missense	probably damaging	0.99
R4495:Syt6	UTSW	3	103587560	nonsense	probably null
R4740:Syt6	UTSW	3	103625656	missense	probably damaging	1.00
R4750:Syt6	UTSW	3	103630917	makesense	probably null
R5668:Syt6	UTSW	3	103620901	missense	probably damaging	1.00
R6185:Syt6	UTSW	3	103585528	missense	probably damaging	1.00
R6660:Syt6	UTSW	3	103625644	missense	probably damaging	1.00
R7120:Syt6	UTSW	3	103587357	missense	probably damaging	1.00
R7307:Syt6	UTSW	3	103587472	missense	probably damaging	1.00
R7501:Syt6	UTSW	3	103587702	missense	probably benign	0.01
R8768:Syt6	UTSW	3	103585534	missense	probably benign
R8867:Syt6	UTSW	3	103627055	missense	possibly damaging	0.91
R8885:Syt6	UTSW	3	103625625	missense	probably benign	0.06
R9068:Syt6	UTSW	3	103587509	nonsense	probably null
R9098:Syt6	UTSW	3	103585579	missense	probably damaging	0.96
R9361:Syt6	UTSW	3	103575363	unclassified	probably benign
Z1177:Syt6	UTSW	3	103645115	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GACTCCGACTCTCTGTGGCAAATG -3'
(R):5'- GGGATGACAAGCAGAATTACCCCAG -3'

Sequencing Primer
(F):5'- atgtctcacacctgtcatctc -3'
(R):5'- GTAAGGATGGTCCATACACTTTCTC -3'

Posted On

2013-07-11