Incidental Mutation 'R0587:Syt6'
ID55799
Institutional Source Beutler Lab
Gene Symbol Syt6
Ensembl Gene ENSMUSG00000027849
Gene Namesynaptotagmin VI
Synonyms3110037A08Rik
MMRRC Submission 038777-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R0587 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location103575231-103645569 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103625571 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 424 (T424A)
Ref Sequence ENSEMBL: ENSMUSP00000112997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090697] [ENSMUST00000117221] [ENSMUST00000118117] [ENSMUST00000118563] [ENSMUST00000121834] [ENSMUST00000132325] [ENSMUST00000136049] [ENSMUST00000151985]
Predicted Effect probably damaging
Transcript: ENSMUST00000090697
AA Change: T424A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088196
Gene: ENSMUSG00000027849
AA Change: T424A

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 93 103 N/A INTRINSIC
C2 246 350 2.65e-20 SMART
C2 378 492 2.25e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117221
AA Change: T339A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113373
Gene: ENSMUSG00000027849
AA Change: T339A

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
C2 293 407 2.25e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118117
AA Change: T339A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112486
Gene: ENSMUSG00000027849
AA Change: T339A

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
C2 293 407 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118563
SMART Domains Protein: ENSMUSP00000113287
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
Pfam:C2 294 332 3.5e-2 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121834
AA Change: T424A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112997
Gene: ENSMUSG00000027849
AA Change: T424A

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 93 103 N/A INTRINSIC
C2 246 350 2.65e-20 SMART
C2 378 492 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132325
SMART Domains Protein: ENSMUSP00000116324
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136049
SMART Domains Protein: ENSMUSP00000118124
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151985
Meta Mutation Damage Score 0.4334 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 94% (34/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the synaptotagmin family. Synaptotagmins share a common domain structure that includes a transmembrane domain and a cytoplasmic region composed of 2 C2 domains, and are involved in calcium-dependent exocytosis of synaptic vesicles. This protein has been shown to be a key component of the secretory machinery involved in acrosomal exocytosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik T C 17: 35,892,963 *212W probably null Het
Abca1 A G 4: 53,107,035 Y231H probably benign Het
Abca5 T G 11: 110,311,377 I401L probably benign Het
Ak2 A G 4: 129,002,378 D112G probably damaging Het
Ankrd60 T A 2: 173,568,851 D292V possibly damaging Het
Bank1 A G 3: 136,214,037 probably benign Het
Bod1l G A 5: 41,821,637 S778L probably benign Het
Cep76 C A 18: 67,623,175 E529* probably null Het
Col24a1 T C 3: 145,293,145 V13A possibly damaging Het
Ctsc T A 7: 88,297,229 H154Q probably benign Het
Ctsf A G 19: 4,855,738 E87G probably benign Het
Dmxl1 A T 18: 49,935,307 T2716S probably benign Het
Espl1 A G 15: 102,303,947 probably benign Het
Fuk T A 8: 110,883,325 Q1019L probably damaging Het
Hnrnpul1 T A 7: 25,745,232 Y217F possibly damaging Het
Kmt2a A T 9: 44,847,534 M1039K probably damaging Het
Large1 T C 8: 72,859,333 N382D probably damaging Het
Madd A G 2: 91,146,885 V1402A probably damaging Het
Mlh3 C T 12: 85,266,419 V998M probably benign Het
Myo1c A G 11: 75,657,790 Y71C probably damaging Het
Myt1l G A 12: 29,811,635 D139N unknown Het
Nes C A 3: 87,978,569 H1378Q probably benign Het
Olfr1259 T C 2: 89,943,392 H241R probably damaging Het
Otud6b T C 4: 14,815,661 E243G probably benign Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Pcm1 G T 8: 41,286,051 R912L probably damaging Het
Piezo2 A G 18: 63,022,426 I2449T possibly damaging Het
Slc12a5 G A 2: 164,976,533 M217I probably damaging Het
Sorl1 C A 9: 41,984,506 W1784C probably damaging Het
Spatc1l A G 10: 76,564,177 R178G possibly damaging Het
Strada A C 11: 106,170,964 Y154D probably damaging Het
Tbx1 C T 16: 18,583,493 A245T possibly damaging Het
Tmem143 T C 7: 45,907,054 L161P probably damaging Het
Other mutations in Syt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Syt6 APN 3 103625626 missense probably damaging 0.98
IGL02944:Syt6 APN 3 103575549 unclassified probably benign
IGL03168:Syt6 APN 3 103587627 missense probably damaging 1.00
PIT4305001:Syt6 UTSW 3 103575453 missense possibly damaging 0.91
R0124:Syt6 UTSW 3 103587526 missense probably damaging 1.00
R0601:Syt6 UTSW 3 103620890 missense probably damaging 1.00
R1262:Syt6 UTSW 3 103585340 critical splice acceptor site probably null
R1970:Syt6 UTSW 3 103587420 missense probably benign 0.21
R4012:Syt6 UTSW 3 103625493 splice site probably benign
R4450:Syt6 UTSW 3 103585645 missense probably benign 0.01
R4493:Syt6 UTSW 3 103585630 missense probably damaging 0.99
R4494:Syt6 UTSW 3 103585630 missense probably damaging 0.99
R4495:Syt6 UTSW 3 103587560 nonsense probably null
R4740:Syt6 UTSW 3 103625656 missense probably damaging 1.00
R4750:Syt6 UTSW 3 103630917 makesense probably null
R5668:Syt6 UTSW 3 103620901 missense probably damaging 1.00
R6185:Syt6 UTSW 3 103585528 missense probably damaging 1.00
R6660:Syt6 UTSW 3 103625644 missense probably damaging 1.00
R7120:Syt6 UTSW 3 103587357 missense probably damaging 1.00
R7307:Syt6 UTSW 3 103587472 missense probably damaging 1.00
R7501:Syt6 UTSW 3 103587702 missense probably benign 0.01
Z1177:Syt6 UTSW 3 103645115 missense unknown
Predicted Primers PCR Primer
(F):5'- GACTCCGACTCTCTGTGGCAAATG -3'
(R):5'- GGGATGACAAGCAGAATTACCCCAG -3'

Sequencing Primer
(F):5'- atgtctcacacctgtcatctc -3'
(R):5'- GTAAGGATGGTCCATACACTTTCTC -3'
Posted On2013-07-11