Mutagenetix > Incidental Mutations

Incidental Mutation 'R7167:Tnks'

557990

Institutional Source

Beutler Lab

Gene Symbol

Tnks

Ensembl Gene

ENSMUSG00000031529

Gene Name

tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Synonyms

mTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7167 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34826460-34965690 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 34849304 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 887 (T887M)

Ref Sequence

ENSEMBL: ENSMUSP00000033929 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033929]

AlphaFold

Q6PFX9

PDB Structure

Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000033929
AA Change: T887M

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: T887M

Domain	Start	End	E-Value	Type
low complexity region	8	17	N/A	INTRINSIC
low complexity region	20	55	N/A	INTRINSIC
low complexity region	68	86	N/A	INTRINSIC
low complexity region	91	175	N/A	INTRINSIC
ANK	208	237	4.26e-4	SMART
ANK	241	270	3.23e-4	SMART
ANK	274	303	3.28e-5	SMART
ANK	327	355	2.66e3	SMART
ANK	361	390	7.64e-6	SMART
ANK	394	423	2.62e-4	SMART
ANK	427	456	1.99e-4	SMART
ANK	514	546	3.18e-3	SMART
ANK	550	579	1.51e-4	SMART
ANK	583	612	4.26e-4	SMART
ANK	642	670	2.21e3	SMART
ANK	676	705	4.03e-5	SMART
ANK	709	738	2.48e-5	SMART
ANK	742	771	1.64e-5	SMART
low complexity region	792	810	N/A	INTRINSIC
ANK	829	858	1.47e-7	SMART
ANK	862	891	2.21e-2	SMART
ANK	895	924	3.13e-2	SMART
low complexity region	996	1010	N/A	INTRINSIC
SAM	1017	1082	1.14e-12	SMART
Pfam:PARP	1098	1303	1.5e-28	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

94% (65/69)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	C	6: 121,647,971	V436A	probably benign	Het
Abcc5	T	C	16: 20,405,501	T111A	possibly damaging	Het
Acsbg2	T	A	17: 56,857,000	D203V	probably benign	Het
Alpk2	G	T	18: 65,306,978	T448K	probably benign	Het
Arhgef2	A	G	3: 88,643,872	N780S	possibly damaging	Het
Atxn2l	T	C	7: 126,499,222	N252S	possibly damaging	Het
Bmpr1b	A	T	3: 141,863,080	L163Q	probably benign	Het
Clca2	T	C	3: 145,097,784	R100G	probably benign	Het
Col2a1	A	G	15: 98,000,456	I79T	unknown	Het
Csmd1	A	G	8: 15,926,524	V2898A	probably benign	Het
Cux1	G	A	5: 136,310,041		probably null	Het
Cyp2u1	A	G	3: 131,303,124	S2P	probably benign	Het
Daam1	C	A	12: 71,988,904	H958N	probably damaging	Het
Dnah7a	C	T	1: 53,503,776	V2412I	probably benign	Het
Ergic2	T	C	6: 148,206,635	R2G	probably damaging	Het
Fam159b	A	G	13: 104,863,658	V19A	probably damaging	Het
Fat2	T	C	11: 55,285,001	T1629A	possibly damaging	Het
Ftl1	T	A	7: 45,459,778		probably benign	Het
Fut8	T	C	12: 77,448,632	V332A	possibly damaging	Het
Gm28363	T	C	1: 117,727,389	S113P	probably damaging	Het
Gm6502	G	A	5: 94,317,125	A457T	possibly damaging	Het
Hfe	A	T	13: 23,708,069	V104E	probably damaging	Het
Ifih1	A	T	2: 62,598,896	N899K	probably benign	Het
Krt75	A	G	15: 101,568,315	S380P	possibly damaging	Het
Meiob	T	G	17: 24,836,445	F409V	probably damaging	Het
Mkrn2os	A	T	6: 115,585,513	I163N	probably damaging	Het
Nanos1	G	T	19: 60,756,608	G115W	probably damaging	Het
Naprt	C	T	15: 75,892,612	A276T	probably damaging	Het
Oas1e	G	T	5: 120,795,422	T26N	probably benign	Het
Olfr1179	A	G	2: 88,402,208	V242A	possibly damaging	Het
Olfr1279	T	C	2: 111,306,448	M81T	probably benign	Het
Olfr355	T	C	2: 36,927,521	I198V	probably benign	Het
Olfr53	T	A	7: 140,652,553	C191*	probably null	Het
Olfr766-ps1	T	G	10: 129,063,272	Q245P	probably damaging	Het
Olfr792	T	C	10: 129,540,738	L67P	possibly damaging	Het
Olfr967	T	C	9: 39,750,569	F61S	probably damaging	Het
Oog2	T	G	4: 144,195,175	D218E	probably benign	Het
Optn	T	C	2: 5,042,483	N207S	probably benign	Het
Oxnad1	G	T	14: 32,101,019	E236*	probably null	Het
Pcdha3	G	A	18: 36,946,993	A263T	probably damaging	Het
Pex13	A	T	11: 23,655,472	W253R	possibly damaging	Het
Pip5k1b	T	A	19: 24,397,069	E49D	probably benign	Het
Plau	C	A	14: 20,839,450	F194L	possibly damaging	Het
Ppm1n	A	G	7: 19,279,741	L95S	probably damaging	Het
Radil	G	T	5: 142,485,505		probably null	Het
Ralgapa2	C	T	2: 146,348,454	M1266I	probably benign	Het
Reln	A	T	5: 21,942,620	L2444Q	probably damaging	Het
Rims2	T	C	15: 39,437,077	V260A	probably benign	Het
Rnase2b	T	A	14: 51,162,765	V101E	probably damaging	Het
Rtp3	T	A	9: 110,986,704	T198S	probably benign	Het
Smad3	T	A	9: 63,666,153	D201V	probably benign	Het
Son	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	16: 91,660,334		probably benign	Het
Spata7	T	G	12: 98,664,296	F371C	probably damaging	Het
Stag1	T	G	9: 100,945,889	N990K	probably benign	Het
Tbx18	C	T	9: 87,707,830	A352T	probably damaging	Het
Thada	C	T	17: 84,230,963	R1539Q	probably benign	Het
Thrap3	A	C	4: 126,185,127		probably benign	Het
Trap1	A	C	16: 4,052,928	V393G	probably damaging	Het
Trpm4	A	G	7: 45,327,719		probably null	Het
Trrap	G	T	5: 144,839,614	G3007C	probably benign	Het
U2surp	A	T	9: 95,481,673	N611K	probably damaging	Het
Usp12	A	G	5: 146,768,935		probably null	Het
Vmn1r200	A	G	13: 22,395,317	T97A	possibly damaging	Het
Vmn2r110	C	T	17: 20,574,179	V743I	probably benign	Het
Vps50	C	T	6: 3,600,256	T905M	probably damaging	Het
Wdr48	T	A	9: 119,907,789		probably null	Het
Zfp446	C	T	7: 12,978,122		probably benign	Het
Zfr	T	C	15: 12,180,929	S1012P	probably benign	Het

Other mutations in Tnks

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Tnks	APN	8	34861689	splice site	probably benign
IGL00901:Tnks	APN	8	34838395	nonsense	probably null
IGL01448:Tnks	APN	8	34839982	missense	probably damaging	1.00
IGL01455:Tnks	APN	8	34940900	missense	probably damaging	0.99
IGL01962:Tnks	APN	8	34869524	missense	probably damaging	1.00
IGL02088:Tnks	APN	8	34839994	missense	possibly damaging	0.50
IGL02260:Tnks	APN	8	34842983	missense	probably damaging	0.99
IGL02454:Tnks	APN	8	34831728	unclassified	probably benign
IGL02486:Tnks	APN	8	34851198	missense	probably damaging	1.00
IGL02612:Tnks	APN	8	34849299	missense	possibly damaging	0.48
IGL03179:Tnks	APN	8	34848670	missense	probably benign	0.38
IGL03404:Tnks	APN	8	34940704	missense	probably damaging	1.00
R0256:Tnks	UTSW	8	34861547	missense	probably benign	0.07
R0265:Tnks	UTSW	8	34839970	nonsense	probably null
R0334:Tnks	UTSW	8	34853259	nonsense	probably null
R0414:Tnks	UTSW	8	34853309	missense	probably damaging	1.00
R0526:Tnks	UTSW	8	34853303	missense	probably benign	0.23
R0622:Tnks	UTSW	8	34940822	missense	probably damaging	1.00
R1445:Tnks	UTSW	8	34834603	splice site	probably benign
R1618:Tnks	UTSW	8	34875276	missense	probably damaging	1.00
R1779:Tnks	UTSW	8	34857518	missense	probably benign	0.18
R1919:Tnks	UTSW	8	34875232	missense	probably damaging	1.00
R1938:Tnks	UTSW	8	34838530	missense	probably damaging	1.00
R2018:Tnks	UTSW	8	34851106	missense	probably damaging	1.00
R2198:Tnks	UTSW	8	34848649	missense	probably benign
R2198:Tnks	UTSW	8	34873067	missense	probably benign	0.29
R2925:Tnks	UTSW	8	34965661	missense	unknown
R3828:Tnks	UTSW	8	34873178	missense	probably damaging	1.00
R3913:Tnks	UTSW	8	34873074	missense	probably damaging	0.99
R3916:Tnks	UTSW	8	34853361	missense	probably damaging	1.00
R3917:Tnks	UTSW	8	34853361	missense	probably damaging	1.00
R3930:Tnks	UTSW	8	34940812	missense	probably damaging	1.00
R4659:Tnks	UTSW	8	34849311	missense	possibly damaging	0.53
R4760:Tnks	UTSW	8	34851783	missense	probably benign	0.38
R5091:Tnks	UTSW	8	34841809	missense	probably benign	0.40
R5419:Tnks	UTSW	8	34965566	missense	unknown
R5558:Tnks	UTSW	8	34965665	start codon destroyed	probably null
R5582:Tnks	UTSW	8	34940861	missense	probably benign	0.14
R6035:Tnks	UTSW	8	34918461	missense	possibly damaging	0.93
R6035:Tnks	UTSW	8	34918461	missense	possibly damaging	0.93
R6495:Tnks	UTSW	8	34839966	critical splice donor site	probably null
R6527:Tnks	UTSW	8	34873093	missense	probably benign	0.36
R6991:Tnks	UTSW	8	34834493	missense	probably damaging	1.00
R7015:Tnks	UTSW	8	34838547	missense	probably benign	0.04
R7038:Tnks	UTSW	8	34851636	missense	probably damaging	0.99
R7057:Tnks	UTSW	8	34840014	missense	probably damaging	1.00
R7250:Tnks	UTSW	8	34851758	missense	probably damaging	0.98
R7475:Tnks	UTSW	8	34831712	missense	probably damaging	1.00
R7790:Tnks	UTSW	8	34861540	missense	probably benign	0.01
R7818:Tnks	UTSW	8	34873028	missense	probably benign	0.03
R7909:Tnks	UTSW	8	34940704	missense	probably damaging	1.00
R7970:Tnks	UTSW	8	34855926	critical splice donor site	probably null
R8341:Tnks	UTSW	8	34873045	missense	probably damaging	1.00
R8343:Tnks	UTSW	8	34834584	missense	probably benign	0.03
R8870:Tnks	UTSW	8	34847279	critical splice donor site	probably null
R8936:Tnks	UTSW	8	34853347	nonsense	probably null
R9049:Tnks	UTSW	8	34841778	missense	probably damaging	0.96
R9080:Tnks	UTSW	8	34965312	small deletion	probably benign
R9182:Tnks	UTSW	8	34841751	critical splice donor site	probably null
R9211:Tnks	UTSW	8	34849335	missense	probably damaging	1.00
R9425:Tnks	UTSW	8	34873665	missense	probably damaging	1.00
Z1177:Tnks	UTSW	8	34965145	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GGTCATGCCTGGAATCCTAATG -3'
(R):5'- GCTGAGTAGGAGACAAGTCC -3'

Sequencing Primer
(F):5'- TGCCTGGAATCCTAATGTACAAC -3'
(R):5'- GCACAGGAGAAGACTGTTTTTG -3'

Posted On

2019-06-26