Incidental Mutation 'R7167:Spata7'
ID558004
Institutional Source Beutler Lab
Gene Symbol Spata7
Ensembl Gene ENSMUSG00000021007
Gene Namespermatogenesis associated 7
SynonymsB230306G18Rik, HSD3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R7167 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location98628157-98669815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 98664296 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 371 (F371C)
Ref Sequence ENSEMBL: ENSMUSP00000045827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048402] [ENSMUST00000101144] [ENSMUST00000101146]
Predicted Effect probably damaging
Transcript: ENSMUST00000048402
AA Change: F371C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045827
Gene: ENSMUSG00000021007
AA Change: F371C

DomainStartEndE-ValueType
Pfam:HSD3 9 410 1e-190 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000101144
AA Change: F204C
SMART Domains Protein: ENSMUSP00000098704
Gene: ENSMUSG00000021007
AA Change: F204C

DomainStartEndE-ValueType
Pfam:HSD3 6 131 7.5e-73 PFAM
Pfam:HSD3 122 244 6e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101146
AA Change: F339C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098705
Gene: ENSMUSG00000021007
AA Change: F339C

DomainStartEndE-ValueType
Pfam:HSD3 6 33 1e-11 PFAM
Pfam:HSD3 31 379 2.1e-171 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 94% (65/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, originally isolated from testis, is also expressed in retina. Mutations in this gene are associated with Leber congenital amaurosis and juvenile retinitis pigmentosa. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele display progressive retinal rod cell degeneration, a thin retinal outer nuclear layer and impaired scotopic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,647,971 V436A probably benign Het
Abcc5 T C 16: 20,405,501 T111A possibly damaging Het
Acsbg2 T A 17: 56,857,000 D203V probably benign Het
Alpk2 G T 18: 65,306,978 T448K probably benign Het
Arhgef2 A G 3: 88,643,872 N780S possibly damaging Het
Atxn2l T C 7: 126,499,222 N252S possibly damaging Het
Bmpr1b A T 3: 141,863,080 L163Q probably benign Het
Clca2 T C 3: 145,097,784 R100G probably benign Het
Col2a1 A G 15: 98,000,456 I79T unknown Het
Csmd1 A G 8: 15,926,524 V2898A probably benign Het
Cux1 G A 5: 136,310,041 probably null Het
Cyp2u1 A G 3: 131,303,124 S2P probably benign Het
Daam1 C A 12: 71,988,904 H958N probably damaging Het
Dnah7a C T 1: 53,503,776 V2412I probably benign Het
Ergic2 T C 6: 148,206,635 R2G probably damaging Het
Fam159b A G 13: 104,863,658 V19A probably damaging Het
Fat2 T C 11: 55,285,001 T1629A possibly damaging Het
Ftl1 T A 7: 45,459,778 probably benign Het
Fut8 T C 12: 77,448,632 V332A possibly damaging Het
Gm28363 T C 1: 117,727,389 S113P probably damaging Het
Gm6502 G A 5: 94,317,125 A457T possibly damaging Het
Hfe A T 13: 23,708,069 V104E probably damaging Het
Ifih1 A T 2: 62,598,896 N899K probably benign Het
Krt75 A G 15: 101,568,315 S380P possibly damaging Het
Meiob T G 17: 24,836,445 F409V probably damaging Het
Mkrn2os A T 6: 115,585,513 I163N probably damaging Het
Nanos1 G T 19: 60,756,608 G115W probably damaging Het
Naprt C T 15: 75,892,612 A276T probably damaging Het
Oas1e G T 5: 120,795,422 T26N probably benign Het
Olfr1179 A G 2: 88,402,208 V242A possibly damaging Het
Olfr1279 T C 2: 111,306,448 M81T probably benign Het
Olfr355 T C 2: 36,927,521 I198V probably benign Het
Olfr53 T A 7: 140,652,553 C191* probably null Het
Olfr766-ps1 T G 10: 129,063,272 Q245P probably damaging Het
Olfr792 T C 10: 129,540,738 L67P possibly damaging Het
Olfr967 T C 9: 39,750,569 F61S probably damaging Het
Oog2 T G 4: 144,195,175 D218E probably benign Het
Optn T C 2: 5,042,483 N207S probably benign Het
Oxnad1 G T 14: 32,101,019 E236* probably null Het
Pcdha3 G A 18: 36,946,993 A263T probably damaging Het
Pex13 A T 11: 23,655,472 W253R possibly damaging Het
Pip5k1b T A 19: 24,397,069 E49D probably benign Het
Plau C A 14: 20,839,450 F194L possibly damaging Het
Ppm1n A G 7: 19,279,741 L95S probably damaging Het
Radil G T 5: 142,485,505 probably null Het
Ralgapa2 C T 2: 146,348,454 M1266I probably benign Het
Reln A T 5: 21,942,620 L2444Q probably damaging Het
Rims2 T C 15: 39,437,077 V260A probably benign Het
Rnase2b T A 14: 51,162,765 V101E probably damaging Het
Rtp3 T A 9: 110,986,704 T198S probably benign Het
Smad3 T A 9: 63,666,153 D201V probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Stag1 T G 9: 100,945,889 N990K probably benign Het
Tbx18 C T 9: 87,707,830 A352T probably damaging Het
Thada C T 17: 84,230,963 R1539Q probably benign Het
Thrap3 A C 4: 126,185,127 probably benign Het
Tnks G A 8: 34,849,304 T887M probably damaging Het
Trap1 A C 16: 4,052,928 V393G probably damaging Het
Trpm4 A G 7: 45,327,719 probably null Het
Trrap G T 5: 144,839,614 G3007C probably benign Het
U2surp A T 9: 95,481,673 N611K probably damaging Het
Usp12 A G 5: 146,768,935 probably null Het
Vmn1r200 A G 13: 22,395,317 T97A possibly damaging Het
Vmn2r110 C T 17: 20,574,179 V743I probably benign Het
Vps50 C T 6: 3,600,256 T905M probably damaging Het
Wdr48 T A 9: 119,907,789 probably null Het
Zfp446 C T 7: 12,978,122 probably benign Het
Zfr T C 15: 12,180,929 S1012P probably benign Het
Other mutations in Spata7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Spata7 APN 12 98668840 missense probably damaging 1.00
IGL02283:Spata7 APN 12 98658258 missense probably damaging 0.96
IGL02379:Spata7 APN 12 98634260 missense probably damaging 1.00
R0200:Spata7 UTSW 12 98663169 missense probably benign 0.32
R0422:Spata7 UTSW 12 98658265 missense probably damaging 0.99
R0847:Spata7 UTSW 12 98648430 missense possibly damaging 0.82
R1228:Spata7 UTSW 12 98634269 missense probably damaging 1.00
R1497:Spata7 UTSW 12 98668861 missense probably damaging 1.00
R1693:Spata7 UTSW 12 98664257 missense possibly damaging 0.85
R2183:Spata7 UTSW 12 98637612 missense probably damaging 1.00
R2507:Spata7 UTSW 12 98658450 missense probably benign
R3176:Spata7 UTSW 12 98637598 missense possibly damaging 0.78
R3177:Spata7 UTSW 12 98637598 missense possibly damaging 0.78
R3276:Spata7 UTSW 12 98637598 missense possibly damaging 0.78
R3277:Spata7 UTSW 12 98637598 missense possibly damaging 0.78
R3951:Spata7 UTSW 12 98669473 missense probably damaging 0.98
R4698:Spata7 UTSW 12 98664277 missense probably damaging 1.00
R4919:Spata7 UTSW 12 98648453 missense possibly damaging 0.65
R5088:Spata7 UTSW 12 98669502 missense probably benign 0.43
R5583:Spata7 UTSW 12 98669331 missense probably damaging 0.98
R6414:Spata7 UTSW 12 98663220 critical splice donor site probably null
R6451:Spata7 UTSW 12 98658337 missense probably benign 0.02
R7316:Spata7 UTSW 12 98658612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTGGGTGCTAATTTCTCAC -3'
(R):5'- GTTTTCTATGGAGTGTGAAACAGC -3'

Sequencing Primer
(F):5'- GTTGGGTGCTAATTTCTCACTTTTAC -3'
(R):5'- CTTTTAAAAAGTCACATAGTGTG -3'
Posted On2019-06-26