Incidental Mutation 'R7167:Hfe'
ID558006
Institutional Source Beutler Lab
Gene Symbol Hfe
Ensembl Gene ENSMUSG00000006611
Gene Namehemochromatosis
SynonymsMR2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7167 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location23702034-23710854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23708069 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 104 (V104E)
Ref Sequence ENSEMBL: ENSMUSP00000089298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006787] [ENSMUST00000091706] [ENSMUST00000091707]
Predicted Effect probably benign
Transcript: ENSMUST00000006787
SMART Domains Protein: ENSMUSP00000006787
Gene: ENSMUSG00000006611

DomainStartEndE-ValueType
IGc1 44 116 1.03e-14 SMART
transmembrane domain 130 152 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091706
AA Change: V104E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089298
Gene: ENSMUSG00000006611
AA Change: V104E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:MHC_I 30 214 4e-46 PFAM
Pfam:MHC_I_3 53 212 7.4e-12 PFAM
IGc1 232 304 1.03e-14 SMART
transmembrane domain 318 340 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091707
SMART Domains Protein: ENSMUSP00000089299
Gene: ENSMUSG00000006611

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:MHC_I 34 126 7.3e-24 PFAM
IGc1 144 216 1.03e-14 SMART
transmembrane domain 230 252 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151243
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 94% (65/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that is similar to MHC class I-type proteins and associates with beta2-microglobulin (beta2M). It is thought that this protein functions to regulate iron absorption by regulating the interaction of the transferrin receptor with transferrin. The iron storage disorder, hereditary haemochromatosis, is a recessive genetic disorder that results from defects in this gene. At least nine alternatively spliced variants have been described for this gene. Additional variants have been found but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutation of this gene affects iron metabolism. Homozygotes for targeted null mutations exhibit increased intestinal iron absorption and an elevated hepatic iron load but reduced duodenal iron stores. Heterozygotes also accumulate more iron than normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,647,971 V436A probably benign Het
Abcc5 T C 16: 20,405,501 T111A possibly damaging Het
Acsbg2 T A 17: 56,857,000 D203V probably benign Het
Alpk2 G T 18: 65,306,978 T448K probably benign Het
Arhgef2 A G 3: 88,643,872 N780S possibly damaging Het
Atxn2l T C 7: 126,499,222 N252S possibly damaging Het
Bmpr1b A T 3: 141,863,080 L163Q probably benign Het
Clca2 T C 3: 145,097,784 R100G probably benign Het
Col2a1 A G 15: 98,000,456 I79T unknown Het
Csmd1 A G 8: 15,926,524 V2898A probably benign Het
Cux1 G A 5: 136,310,041 probably null Het
Cyp2u1 A G 3: 131,303,124 S2P probably benign Het
Daam1 C A 12: 71,988,904 H958N probably damaging Het
Dnah7a C T 1: 53,503,776 V2412I probably benign Het
Ergic2 T C 6: 148,206,635 R2G probably damaging Het
Fam159b A G 13: 104,863,658 V19A probably damaging Het
Fat2 T C 11: 55,285,001 T1629A possibly damaging Het
Ftl1 T A 7: 45,459,778 probably benign Het
Fut8 T C 12: 77,448,632 V332A possibly damaging Het
Gm28363 T C 1: 117,727,389 S113P probably damaging Het
Gm6502 G A 5: 94,317,125 A457T possibly damaging Het
Ifih1 A T 2: 62,598,896 N899K probably benign Het
Krt75 A G 15: 101,568,315 S380P possibly damaging Het
Meiob T G 17: 24,836,445 F409V probably damaging Het
Mkrn2os A T 6: 115,585,513 I163N probably damaging Het
Nanos1 G T 19: 60,756,608 G115W probably damaging Het
Naprt C T 15: 75,892,612 A276T probably damaging Het
Oas1e G T 5: 120,795,422 T26N probably benign Het
Olfr1179 A G 2: 88,402,208 V242A possibly damaging Het
Olfr1279 T C 2: 111,306,448 M81T probably benign Het
Olfr355 T C 2: 36,927,521 I198V probably benign Het
Olfr53 T A 7: 140,652,553 C191* probably null Het
Olfr766-ps1 T G 10: 129,063,272 Q245P probably damaging Het
Olfr792 T C 10: 129,540,738 L67P possibly damaging Het
Olfr967 T C 9: 39,750,569 F61S probably damaging Het
Oog2 T G 4: 144,195,175 D218E probably benign Het
Optn T C 2: 5,042,483 N207S probably benign Het
Oxnad1 G T 14: 32,101,019 E236* probably null Het
Pcdha3 G A 18: 36,946,993 A263T probably damaging Het
Pex13 A T 11: 23,655,472 W253R possibly damaging Het
Pip5k1b T A 19: 24,397,069 E49D probably benign Het
Plau C A 14: 20,839,450 F194L possibly damaging Het
Ppm1n A G 7: 19,279,741 L95S probably damaging Het
Radil G T 5: 142,485,505 probably null Het
Ralgapa2 C T 2: 146,348,454 M1266I probably benign Het
Reln A T 5: 21,942,620 L2444Q probably damaging Het
Rims2 T C 15: 39,437,077 V260A probably benign Het
Rnase2b T A 14: 51,162,765 V101E probably damaging Het
Rtp3 T A 9: 110,986,704 T198S probably benign Het
Smad3 T A 9: 63,666,153 D201V probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Spata7 T G 12: 98,664,296 F371C probably damaging Het
Stag1 T G 9: 100,945,889 N990K probably benign Het
Tbx18 C T 9: 87,707,830 A352T probably damaging Het
Thada C T 17: 84,230,963 R1539Q probably benign Het
Thrap3 A C 4: 126,185,127 probably benign Het
Tnks G A 8: 34,849,304 T887M probably damaging Het
Trap1 A C 16: 4,052,928 V393G probably damaging Het
Trpm4 A G 7: 45,327,719 probably null Het
Trrap G T 5: 144,839,614 G3007C probably benign Het
U2surp A T 9: 95,481,673 N611K probably damaging Het
Usp12 A G 5: 146,768,935 probably null Het
Vmn1r200 A G 13: 22,395,317 T97A possibly damaging Het
Vmn2r110 C T 17: 20,574,179 V743I probably benign Het
Vps50 C T 6: 3,600,256 T905M probably damaging Het
Wdr48 T A 9: 119,907,789 probably null Het
Zfp446 C T 7: 12,978,122 probably benign Het
Zfr T C 15: 12,180,929 S1012P probably benign Het
Other mutations in Hfe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Hfe APN 13 23705852 unclassified probably benign
IGL01733:Hfe APN 13 23706865 missense possibly damaging 0.51
IGL02227:Hfe APN 13 23706943 missense probably benign 0.26
IGL02339:Hfe APN 13 23704390 missense probably damaging 0.98
R1669:Hfe UTSW 13 23706127 nonsense probably null
R1704:Hfe UTSW 13 23704408 missense probably damaging 1.00
R4424:Hfe UTSW 13 23706883 missense probably benign 0.06
R4624:Hfe UTSW 13 23706078 nonsense probably null
R4904:Hfe UTSW 13 23708054 missense probably damaging 1.00
R5926:Hfe UTSW 13 23708264 missense probably damaging 0.99
R6246:Hfe UTSW 13 23708229 missense probably damaging 1.00
R6322:Hfe UTSW 13 23705896 missense probably damaging 1.00
R6636:Hfe UTSW 13 23706795 missense possibly damaging 0.53
R6636:Hfe UTSW 13 23706796 missense possibly damaging 0.88
R6637:Hfe UTSW 13 23706795 missense possibly damaging 0.53
R6637:Hfe UTSW 13 23706796 missense possibly damaging 0.88
R7374:Hfe UTSW 13 23706047 missense probably damaging 0.99
R7816:Hfe UTSW 13 23704399 missense possibly damaging 0.53
Z1177:Hfe UTSW 13 23706037 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGGTTAGCAGACAGAGGC -3'
(R):5'- ATTCTCTAAGATACCTCTTCATGGG -3'

Sequencing Primer
(F):5'- GCAGAGAGCCTCCTAGACATC -3'
(R):5'- CTCTTCATGGGTGCCTCAGAG -3'
Posted On2019-06-26