Mutagenetix > Incidental Mutations

Incidental Mutation 'R0587:Abca1'

55802

Institutional Source

Beutler Lab

Gene Symbol

Abca1

Ensembl Gene

ENSMUSG00000015243

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 1

Synonyms

ABC1

MMRRC Submission

038777-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0587 (G1)

Quality Score

204

Status

Validated

Chromosome

Chromosomal Location

53030787-53159895 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 53107035 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 231 (Y231H)

Ref Sequence

ENSEMBL: ENSMUSP00000030010 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030010]

Predicted Effect

probably benign
Transcript: ENSMUST00000030010
AA Change: Y231H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243
AA Change: Y231H

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
Pfam:ABC2_membrane_3	395	841	4.9e-14	PFAM
AAA	925	1122	4.2e-10	SMART
low complexity region	1137	1150	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1344	1869	1.7e-53	PFAM
low complexity region	1890	1899	N/A	INTRINSIC
AAA	1938	2123	3.04e-7	SMART
low complexity region	2176	2187	N/A	INTRINSIC
low complexity region	2222	2237	N/A	INTRINSIC

Meta Mutation Damage Score

0.1068

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.3%

Validation Efficiency

94% (34/36)

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061I04Rik	T	C	17: 35,892,963	*212W	probably null	Het
Abca5	T	G	11: 110,311,377	I401L	probably benign	Het
Ak2	A	G	4: 129,002,378	D112G	probably damaging	Het
Ankrd60	T	A	2: 173,568,851	D292V	possibly damaging	Het
Bank1	A	G	3: 136,214,037		probably benign	Het
Bod1l	G	A	5: 41,821,637	S778L	probably benign	Het
Cep76	C	A	18: 67,623,175	E529*	probably null	Het
Col24a1	T	C	3: 145,293,145	V13A	possibly damaging	Het
Ctsc	T	A	7: 88,297,229	H154Q	probably benign	Het
Ctsf	A	G	19: 4,855,738	E87G	probably benign	Het
Dmxl1	A	T	18: 49,935,307	T2716S	probably benign	Het
Espl1	A	G	15: 102,303,947		probably benign	Het
Fuk	T	A	8: 110,883,325	Q1019L	probably damaging	Het
Hnrnpul1	T	A	7: 25,745,232	Y217F	possibly damaging	Het
Kmt2a	A	T	9: 44,847,534	M1039K	probably damaging	Het
Large1	T	C	8: 72,859,333	N382D	probably damaging	Het
Madd	A	G	2: 91,146,885	V1402A	probably damaging	Het
Mlh3	C	T	12: 85,266,419	V998M	probably benign	Het
Myo1c	A	G	11: 75,657,790	Y71C	probably damaging	Het
Myt1l	G	A	12: 29,811,635	D139N	unknown	Het
Nes	C	A	3: 87,978,569	H1378Q	probably benign	Het
Olfr1259	T	C	2: 89,943,392	H241R	probably damaging	Het
Otud6b	T	C	4: 14,815,661	E243G	probably benign	Het
Pak3	TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	X: 143,743,893		probably benign	Het
Pcm1	G	T	8: 41,286,051	R912L	probably damaging	Het
Piezo2	A	G	18: 63,022,426	I2449T	possibly damaging	Het
Slc12a5	G	A	2: 164,976,533	M217I	probably damaging	Het
Sorl1	C	A	9: 41,984,506	W1784C	probably damaging	Het
Spatc1l	A	G	10: 76,564,177	R178G	possibly damaging	Het
Strada	A	C	11: 106,170,964	Y154D	probably damaging	Het
Syt6	A	G	3: 103,625,571	T424A	probably damaging	Het
Tbx1	C	T	16: 18,583,493	A245T	possibly damaging	Het
Tmem143	T	C	7: 45,907,054	L161P	probably damaging	Het

Other mutations in Abca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Abca1	APN	4	53059255	critical splice donor site	probably null
IGL00778:Abca1	APN	4	53086132	missense	probably benign
IGL01013:Abca1	APN	4	53038185	nonsense	probably null
IGL01510:Abca1	APN	4	53143979	missense	probably damaging	0.97
IGL01608:Abca1	APN	4	53038158	missense	probably damaging	1.00
IGL01845:Abca1	APN	4	53090297	missense	probably damaging	1.00
IGL02048:Abca1	APN	4	53069831	missense	probably damaging	1.00
IGL02249:Abca1	APN	4	53068739	nonsense	probably null
IGL02569:Abca1	APN	4	53034061	missense	probably damaging	1.00
IGL02622:Abca1	APN	4	53034046	missense	probably damaging	0.99
R0042:Abca1	UTSW	4	53059245	splice site	probably benign
R0042:Abca1	UTSW	4	53059245	splice site	probably benign
R0050:Abca1	UTSW	4	53069910	splice site	probably benign
R0107:Abca1	UTSW	4	53080834	missense	probably benign	0.00
R0127:Abca1	UTSW	4	53067155	missense	probably benign	0.00
R0178:Abca1	UTSW	4	53081953	missense	possibly damaging	0.89
R0207:Abca1	UTSW	4	53086039	missense	probably damaging	0.97
R0267:Abca1	UTSW	4	53046105	missense	probably damaging	1.00
R0269:Abca1	UTSW	4	53044228	missense	probably benign
R0586:Abca1	UTSW	4	53092860	missense	probably benign	0.00
R1403:Abca1	UTSW	4	53059253	splice site	probably benign
R1404:Abca1	UTSW	4	53059253	splice site	probably benign
R1405:Abca1	UTSW	4	53059253	splice site	probably benign
R1558:Abca1	UTSW	4	53092887	missense	probably null	0.00
R1655:Abca1	UTSW	4	53050964	missense	probably benign
R1662:Abca1	UTSW	4	53090251	splice site	probably null
R1769:Abca1	UTSW	4	53074325	missense	probably damaging	1.00
R1898:Abca1	UTSW	4	53071977	missense	probably benign	0.08
R1945:Abca1	UTSW	4	53061509	frame shift	probably null
R1966:Abca1	UTSW	4	53050409	missense	probably damaging	1.00
R2055:Abca1	UTSW	4	53069881	missense	probably benign
R2185:Abca1	UTSW	4	53089830	missense	probably benign	0.12
R2202:Abca1	UTSW	4	53090291	missense	probably damaging	0.96
R2203:Abca1	UTSW	4	53090291	missense	probably damaging	0.96
R2204:Abca1	UTSW	4	53090291	missense	probably damaging	0.96
R3056:Abca1	UTSW	4	53127626	missense	probably benign
R3849:Abca1	UTSW	4	53061481	splice site	probably benign
R3850:Abca1	UTSW	4	53061481	splice site	probably benign
R3906:Abca1	UTSW	4	53067151	missense	possibly damaging	0.84
R3908:Abca1	UTSW	4	53067151	missense	possibly damaging	0.84
R4050:Abca1	UTSW	4	53044144	missense	probably damaging	1.00
R4204:Abca1	UTSW	4	53090369	missense	probably benign	0.00
R4225:Abca1	UTSW	4	53085106	missense	possibly damaging	0.87
R4577:Abca1	UTSW	4	53062568	missense	possibly damaging	0.94
R4979:Abca1	UTSW	4	53085092	splice site	probably null
R5022:Abca1	UTSW	4	53041570	frame shift	probably null
R5168:Abca1	UTSW	4	53086070	missense	probably benign
R5363:Abca1	UTSW	4	53132963	missense	probably benign	0.00
R5439:Abca1	UTSW	4	53042381	missense	possibly damaging	0.55
R5604:Abca1	UTSW	4	53067168	splice site	probably null
R5614:Abca1	UTSW	4	53046132	missense	probably damaging	1.00
R5810:Abca1	UTSW	4	53079631	missense	probably benign
R6001:Abca1	UTSW	4	53075555	missense	possibly damaging	0.68
R6151:Abca1	UTSW	4	53085261	missense	probably benign
R6185:Abca1	UTSW	4	53078089	missense	probably benign	0.31
R6262:Abca1	UTSW	4	53092917	missense	probably benign	0.01
R6455:Abca1	UTSW	4	53042376	missense	probably damaging	0.98
R6472:Abca1	UTSW	4	53085991	critical splice donor site	probably null
R6564:Abca1	UTSW	4	53034031	missense	possibly damaging	0.85
R6720:Abca1	UTSW	4	53083733	missense	probably damaging	1.00
R6903:Abca1	UTSW	4	53143952	missense	probably benign	0.17
R6960:Abca1	UTSW	4	53072924	missense	probably benign	0.00
R7065:Abca1	UTSW	4	53074233	missense	probably damaging	0.98
R7142:Abca1	UTSW	4	53082050	missense	probably damaging	1.00
R7322:Abca1	UTSW	4	53067151	missense	probably damaging	0.97
R7520:Abca1	UTSW	4	53078114	missense	probably benign
R7547:Abca1	UTSW	4	53109269	missense	probably benign	0.02
X0023:Abca1	UTSW	4	53049038	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- AGAACACCCAGAGTATGACTGGGC -3'
(R):5'- ACGGTATAATTGTTTCCATGAGGCAGC -3'

Sequencing Primer
(F):5'- GACTGGGCTAAATTATATCACCAAG -3'
(R):5'- AGATGTACTGAGGTTACACTCCC -3'

Posted On

2013-07-11