Incidental Mutation 'R7168:Trhr2'
ID558060
Institutional Source Beutler Lab
Gene Symbol Trhr2
Ensembl Gene ENSMUSG00000039079
Gene Namethyrotropin releasing hormone receptor 2
SynonymsTRH-R2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R7168 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location122356967-122360746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122360537 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 55 (T55S)
Ref Sequence ENSEMBL: ENSMUSP00000042575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044123] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000044123
AA Change: T55S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042575
Gene: ENSMUSG00000039079
AA Change: T55S

DomainStartEndE-ValueType
Pfam:7tm_4 29 184 1e-12 PFAM
Pfam:7TM_GPCR_Srv 29 325 2e-7 PFAM
Pfam:7TM_GPCR_Srx 30 165 4.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 33 323 5.6e-10 PFAM
Pfam:7tm_1 39 308 5.4e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,216,057 D1388V probably damaging Het
2810474O19Rik T G 6: 149,327,843 F796V probably benign Het
2900026A02Rik C A 5: 113,137,793 R65L probably damaging Het
Abcb10 A T 8: 123,966,611 L318Q Het
Abhd18 T A 3: 40,934,936 V417D probably damaging Het
Actl7a A G 4: 56,743,769 K99E probably benign Het
Adam2 A T 14: 66,058,792 I206N possibly damaging Het
Adgrv1 G T 13: 81,397,209 S5652R possibly damaging Het
Aebp2 C T 6: 140,633,700 T221M probably damaging Het
Ahi1 T A 10: 21,017,932 M854K probably benign Het
Alpi T A 1: 87,099,433 T375S possibly damaging Het
Apip T A 2: 103,092,468 C210* probably null Het
Arid3b A T 9: 57,805,535 D232E probably benign Het
Asic5 G A 3: 82,011,975 C342Y probably damaging Het
BC035947 T C 1: 78,499,593 M101V probably benign Het
Brd3 G A 2: 27,454,399 R440C possibly damaging Het
Deaf1 C T 7: 141,324,596 probably benign Het
Eif2ak3 A G 6: 70,881,626 T300A probably benign Het
Eml6 T A 11: 29,838,529 I519F probably benign Het
Fat4 T C 3: 38,980,659 F2820S probably damaging Het
Fcho2 A G 13: 98,789,463 I132T probably benign Het
Garnl3 A G 2: 32,995,078 V810A probably damaging Het
Gm14403 A C 2: 177,509,525 Q179P probably damaging Het
Gm3127 A G 14: 4,172,501 M251V probably benign Het
Hook3 A G 8: 26,071,086 S298P probably benign Het
Impact T A 18: 12,986,313 probably null Het
Itgal T C 7: 127,330,213 F1101L probably benign Het
Itih1 C T 14: 30,934,107 R579Q probably null Het
Kansl2 T C 15: 98,529,544 probably null Het
Kng1 A G 16: 23,079,641 D597G probably benign Het
Kpna1 A G 16: 36,015,962 probably benign Het
Lama2 C T 10: 27,366,152 probably null Het
Ltbp1 G T 17: 75,291,366 C614F probably damaging Het
Luc7l3 T C 11: 94,299,984 E168G unknown Het
Lvrn A C 18: 46,881,322 K525T probably benign Het
Mdn1 G A 4: 32,719,184 R2249H probably damaging Het
Mmp16 G T 4: 18,110,550 G449C probably damaging Het
Mst1r T C 9: 107,908,193 V350A probably benign Het
Muc5b A G 7: 141,864,017 M3567V probably benign Het
Mybl1 A T 1: 9,678,288 L361Q probably damaging Het
Myom1 T A 17: 71,089,947 S1063R probably benign Het
Notch4 A C 17: 34,572,693 H582P probably benign Het
Nwd2 T A 5: 63,807,494 C1474S probably benign Het
Olfr1163 A C 2: 88,070,577 N268K probably benign Het
Olfr1284 A T 2: 111,379,879 D293V probably damaging Het
Olfr1338 A T 4: 118,753,851 I231N probably damaging Het
Olfr889 G T 9: 38,116,663 S294I probably damaging Het
Pcmt1 A T 10: 7,638,182 V241D probably damaging Het
Plcl1 T A 1: 55,697,463 N654K probably damaging Het
Plg G A 17: 12,388,559 G121D probably damaging Het
Ptch1 A G 13: 63,512,060 S1260P probably benign Het
Pwp1 G T 10: 85,884,537 R346I probably damaging Het
R3hdm1 C T 1: 128,216,495 T800I probably benign Het
Rab3gap2 A G 1: 185,204,297 D19G possibly damaging Het
Slc1a3 G T 15: 8,645,902 N206K possibly damaging Het
Slc6a3 T C 13: 73,571,472 V540A probably benign Het
Sntb1 G A 15: 55,791,265 P265S probably benign Het
Timm29 T C 9: 21,593,453 V139A probably damaging Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tm2d3 T A 7: 65,693,926 V56E probably benign Het
Trim17 T G 11: 58,968,578 V206G probably benign Het
Trpm1 A G 7: 64,268,697 N1479S probably benign Het
Trpv2 T A 11: 62,583,088 C190S probably benign Het
Umod A T 7: 119,478,326 probably benign Het
Usp34 T A 11: 23,464,585 Y2862N Het
Vmn1r158 A G 7: 22,790,676 V36A possibly damaging Het
Zfp420 A G 7: 29,875,366 Y337C probably damaging Het
Other mutations in Trhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03070:Trhr2 APN 8 122358603 missense probably benign
IGL03387:Trhr2 APN 8 122358481 intron probably benign
IGL03408:Trhr2 APN 8 122358795 missense probably damaging 1.00
R0546:Trhr2 UTSW 8 122358489 critical splice donor site probably null
R1135:Trhr2 UTSW 8 122358633 missense probably damaging 1.00
R1377:Trhr2 UTSW 8 122360588 missense probably damaging 1.00
R1656:Trhr2 UTSW 8 122357446 missense probably damaging 1.00
R2055:Trhr2 UTSW 8 122358793 missense probably damaging 1.00
R4030:Trhr2 UTSW 8 122360699 start codon destroyed probably null 0.01
R4998:Trhr2 UTSW 8 122358772 missense probably benign 0.04
R5074:Trhr2 UTSW 8 122357371 missense probably benign 0.01
R6175:Trhr2 UTSW 8 122357379 missense probably damaging 0.99
R7048:Trhr2 UTSW 8 122358679 missense probably damaging 1.00
R7185:Trhr2 UTSW 8 122360657 missense probably benign 0.26
R7284:Trhr2 UTSW 8 122360375 missense probably damaging 1.00
R7314:Trhr2 UTSW 8 122358750 missense possibly damaging 0.64
R7644:Trhr2 UTSW 8 122357322 missense possibly damaging 0.93
R7891:Trhr2 UTSW 8 122357344 missense probably damaging 0.99
R7974:Trhr2 UTSW 8 122357344 missense probably damaging 0.99
Z1176:Trhr2 UTSW 8 122358795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCTCTCCACAGTGAAGG -3'
(R):5'- TCACTTACCAAGGTCAAGGCC -3'

Sequencing Primer
(F):5'- CTCCACAGTGAAGGCCAGGATG -3'
(R):5'- GGGCATCACAGAAGACGCC -3'
Posted On2019-06-26