Incidental Mutation 'R7168:Pcmt1'
ID558065
Institutional Source Beutler Lab
Gene Symbol Pcmt1
Ensembl Gene ENSMUSG00000019795
Gene Nameprotein-L-isoaspartate (D-aspartate) O-methyltransferase 1
SynonymsPIMT, protein carboxyl methyltransferase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R7168 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location7629373-7681136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7638182 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 241 (V241D)
Ref Sequence ENSEMBL: ENSMUSP00000123866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159917] [ENSMUST00000161123] [ENSMUST00000162606] [ENSMUST00000163085]
Predicted Effect probably damaging
Transcript: ENSMUST00000159917
AA Change: V241D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124932
Gene: ENSMUSG00000019795
AA Change: V241D

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:PCMT 66 279 1.1e-88 PFAM
Pfam:Ubie_methyltran 126 258 3.4e-7 PFAM
Pfam:Methyltransf_31 134 284 1.1e-8 PFAM
Pfam:Methyltransf_18 136 241 3e-9 PFAM
Pfam:Methyltransf_11 141 239 1.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161123
SMART Domains Protein: ENSMUSP00000124100
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:PCMT 53 108 4.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161428
SMART Domains Protein: ENSMUSP00000123758
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
Pfam:PCMT 1 160 2.7e-61 PFAM
Pfam:Ubie_methyltran 49 148 8.3e-7 PFAM
Pfam:Methyltransf_31 58 111 3.9e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162606
AA Change: V241D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123866
Gene: ENSMUSG00000019795
AA Change: V241D

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:PCMT 66 279 2e-88 PFAM
Pfam:Ubie_methyltran 126 259 1e-6 PFAM
Pfam:Methyltransf_31 134 283 3.5e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163085
AA Change: V227D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125144
Gene: ENSMUSG00000019795
AA Change: V227D

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:PCMT 52 265 9.1e-89 PFAM
Pfam:Ubie_methyltran 112 244 3.1e-7 PFAM
Pfam:Methyltransf_31 120 270 9.8e-9 PFAM
Pfam:Methyltransf_18 122 227 2.7e-9 PFAM
Pfam:Methyltransf_11 127 225 1.4e-6 PFAM
Meta Mutation Damage Score 0.9665 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene causes accumulation of modified proteins, growth retardation and fatal epileptic seizures. Homozygotes for one null allele also show a small spleen, altered lipid, hormone, mineral and enzyme profiles, kyphosis, enlarged brain and abnormal dendritic arborizations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,216,057 D1388V probably damaging Het
2810474O19Rik T G 6: 149,327,843 F796V probably benign Het
2900026A02Rik C A 5: 113,137,793 R65L probably damaging Het
Abcb10 A T 8: 123,966,611 L318Q Het
Abhd18 T A 3: 40,934,936 V417D probably damaging Het
Actl7a A G 4: 56,743,769 K99E probably benign Het
Adam2 A T 14: 66,058,792 I206N possibly damaging Het
Adgrv1 G T 13: 81,397,209 S5652R possibly damaging Het
Aebp2 C T 6: 140,633,700 T221M probably damaging Het
Ahi1 T A 10: 21,017,932 M854K probably benign Het
Alpi T A 1: 87,099,433 T375S possibly damaging Het
Apip T A 2: 103,092,468 C210* probably null Het
Arid3b A T 9: 57,805,535 D232E probably benign Het
Asic5 G A 3: 82,011,975 C342Y probably damaging Het
BC035947 T C 1: 78,499,593 M101V probably benign Het
Brd3 G A 2: 27,454,399 R440C possibly damaging Het
Deaf1 C T 7: 141,324,596 probably benign Het
Eif2ak3 A G 6: 70,881,626 T300A probably benign Het
Eml6 T A 11: 29,838,529 I519F probably benign Het
Fat4 T C 3: 38,980,659 F2820S probably damaging Het
Fcho2 A G 13: 98,789,463 I132T probably benign Het
Garnl3 A G 2: 32,995,078 V810A probably damaging Het
Gm14403 A C 2: 177,509,525 Q179P probably damaging Het
Gm3127 A G 14: 4,172,501 M251V probably benign Het
Hook3 A G 8: 26,071,086 S298P probably benign Het
Impact T A 18: 12,986,313 probably null Het
Itgal T C 7: 127,330,213 F1101L probably benign Het
Itih1 C T 14: 30,934,107 R579Q probably null Het
Kansl2 T C 15: 98,529,544 probably null Het
Kng1 A G 16: 23,079,641 D597G probably benign Het
Kpna1 A G 16: 36,015,962 probably benign Het
Lama2 C T 10: 27,366,152 probably null Het
Ltbp1 G T 17: 75,291,366 C614F probably damaging Het
Luc7l3 T C 11: 94,299,984 E168G unknown Het
Lvrn A C 18: 46,881,322 K525T probably benign Het
Mdn1 G A 4: 32,719,184 R2249H probably damaging Het
Mmp16 G T 4: 18,110,550 G449C probably damaging Het
Mst1r T C 9: 107,908,193 V350A probably benign Het
Muc5b A G 7: 141,864,017 M3567V probably benign Het
Mybl1 A T 1: 9,678,288 L361Q probably damaging Het
Myom1 T A 17: 71,089,947 S1063R probably benign Het
Notch4 A C 17: 34,572,693 H582P probably benign Het
Nwd2 T A 5: 63,807,494 C1474S probably benign Het
Olfr1163 A C 2: 88,070,577 N268K probably benign Het
Olfr1284 A T 2: 111,379,879 D293V probably damaging Het
Olfr1338 A T 4: 118,753,851 I231N probably damaging Het
Olfr889 G T 9: 38,116,663 S294I probably damaging Het
Plcl1 T A 1: 55,697,463 N654K probably damaging Het
Plg G A 17: 12,388,559 G121D probably damaging Het
Ptch1 A G 13: 63,512,060 S1260P probably benign Het
Pwp1 G T 10: 85,884,537 R346I probably damaging Het
R3hdm1 C T 1: 128,216,495 T800I probably benign Het
Rab3gap2 A G 1: 185,204,297 D19G possibly damaging Het
Slc1a3 G T 15: 8,645,902 N206K possibly damaging Het
Slc6a3 T C 13: 73,571,472 V540A probably benign Het
Sntb1 G A 15: 55,791,265 P265S probably benign Het
Timm29 T C 9: 21,593,453 V139A probably damaging Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tm2d3 T A 7: 65,693,926 V56E probably benign Het
Trhr2 T A 8: 122,360,537 T55S probably damaging Het
Trim17 T G 11: 58,968,578 V206G probably benign Het
Trpm1 A G 7: 64,268,697 N1479S probably benign Het
Trpv2 T A 11: 62,583,088 C190S probably benign Het
Umod A T 7: 119,478,326 probably benign Het
Usp34 T A 11: 23,464,585 Y2862N Het
Vmn1r158 A G 7: 22,790,676 V36A possibly damaging Het
Zfp420 A G 7: 29,875,366 Y337C probably damaging Het
Other mutations in Pcmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02934:Pcmt1 APN 10 7640727 missense probably benign 0.00
R1968:Pcmt1 UTSW 10 7640710 nonsense probably null
R3889:Pcmt1 UTSW 10 7649050 critical splice donor site probably null
R5454:Pcmt1 UTSW 10 7640745 missense probably damaging 1.00
R5630:Pcmt1 UTSW 10 7649093 missense probably damaging 1.00
R5705:Pcmt1 UTSW 10 7638190 missense possibly damaging 0.86
R6667:Pcmt1 UTSW 10 7663149 missense probably damaging 1.00
R7163:Pcmt1 UTSW 10 7638158 missense probably benign 0.01
R7531:Pcmt1 UTSW 10 7680605 intron probably null
R8012:Pcmt1 UTSW 10 7640763 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GCTAAGGTCTTAAAGCCCACAG -3'
(R):5'- TGAAATGAACCCCTGAGGACG -3'

Sequencing Primer
(F):5'- CCTTTCACCTTGACTGTGTGGAG -3'
(R):5'- CCTGAGGACGCTAAGATGTTC -3'
Posted On2019-06-26