Incidental Mutation 'R7168:Lama2'
ID558067
Institutional Source Beutler Lab
Gene Symbol Lama2
Ensembl Gene ENSMUSG00000019899
Gene Namelaminin, alpha 2
Synonymsmerosin, mer
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.440) question?
Stock #R7168 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location26980036-27619758 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) C to T at 27366152 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092639] [ENSMUST00000189575]
PDB Structure
LAMININ ALPHA 2 CHAIN LG4-5 DOMAIN PAIR [X-RAY DIFFRACTION]
LAMININ ALPHA 2 CHAIN LG4-5 DOMAIN PAIR, CA1 SITE MUTANT [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE FIFTH LAMININ G-LIKE MODULE OF THE MOUSE LAMININ ALPHA2 CHAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE LG1-3 REGION OF THE LAMININ ALPHA2 CHAIN [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000092639
SMART Domains Protein: ENSMUSP00000090304
Gene: ENSMUSG00000019899

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 5.35e-129 SMART
EGF_Lam 283 337 2.11e-4 SMART
EGF_Lam 340 407 1.59e-8 SMART
EGF_Lam 410 462 5.44e-7 SMART
EGF_Lam 465 511 9.05e-4 SMART
LamB 574 706 2.26e-44 SMART
Pfam:Laminin_EGF 715 745 2.8e-4 PFAM
EGF_Lam 753 800 4.03e-10 SMART
EGF_Lam 803 858 3.01e-9 SMART
EGF_Lam 861 911 1.35e-11 SMART
EGF_Lam 914 960 7.23e-12 SMART
EGF_Lam 963 1007 5.87e-12 SMART
EGF_Lam 1010 1053 1.28e-12 SMART
EGF_Lam 1056 1099 2.37e-7 SMART
EGF_Lam 1102 1159 3.22e-9 SMART
LamB 1225 1360 1.95e-57 SMART
EGF_like 1364 1413 8.13e-1 SMART
EGF_Lam 1416 1462 5.48e-12 SMART
EGF_Lam 1465 1520 1.27e-7 SMART
EGF_Lam 1523 1567 2.4e-8 SMART
Pfam:Laminin_I 1584 1849 2e-92 PFAM
Blast:MA 1881 2113 1e-112 BLAST
LamG 2162 2307 1.28e-25 SMART
LamG 2356 2500 2.2e-33 SMART
LamG 2542 2688 3.31e-28 SMART
low complexity region 2725 2741 N/A INTRINSIC
LamG 2781 2914 2.25e-39 SMART
LamG 2956 3092 1.53e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000189575
SMART Domains Protein: ENSMUSP00000140716
Gene: ENSMUSG00000019899

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 2.5e-131 SMART
EGF_Lam 283 337 1e-6 SMART
EGF_Lam 340 407 7.7e-11 SMART
EGF_Lam 410 462 2.6e-9 SMART
EGF_Lam 465 511 4.5e-6 SMART
LamB 574 706 1.4e-46 SMART
Pfam:Laminin_EGF 715 745 1.7e-2 PFAM
EGF_Lam 753 800 1.9e-12 SMART
EGF_Lam 803 858 1.4e-11 SMART
EGF_Lam 861 911 6.7e-14 SMART
EGF_Lam 914 960 3.6e-14 SMART
EGF_Lam 963 1007 2.9e-14 SMART
EGF_Lam 1010 1053 6.1e-15 SMART
EGF_Lam 1056 1099 1.1e-9 SMART
EGF_Lam 1102 1159 1.5e-11 SMART
LamB 1225 1349 1.4e-45 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit progressive growth retardation, ataxia, muscle atrophy and degeneration, infertility, and premature lethality. Muscle fiber degeneration is evident as early as the first week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,216,057 D1388V probably damaging Het
2810474O19Rik T G 6: 149,327,843 F796V probably benign Het
2900026A02Rik C A 5: 113,137,793 R65L probably damaging Het
Abcb10 A T 8: 123,966,611 L318Q Het
Abhd18 T A 3: 40,934,936 V417D probably damaging Het
Actl7a A G 4: 56,743,769 K99E probably benign Het
Adam2 A T 14: 66,058,792 I206N possibly damaging Het
Adgrv1 G T 13: 81,397,209 S5652R possibly damaging Het
Aebp2 C T 6: 140,633,700 T221M probably damaging Het
Ahi1 T A 10: 21,017,932 M854K probably benign Het
Alpi T A 1: 87,099,433 T375S possibly damaging Het
Apip T A 2: 103,092,468 C210* probably null Het
Arid3b A T 9: 57,805,535 D232E probably benign Het
Asic5 G A 3: 82,011,975 C342Y probably damaging Het
BC035947 T C 1: 78,499,593 M101V probably benign Het
Brd3 G A 2: 27,454,399 R440C possibly damaging Het
Deaf1 C T 7: 141,324,596 probably benign Het
Eif2ak3 A G 6: 70,881,626 T300A probably benign Het
Eml6 T A 11: 29,838,529 I519F probably benign Het
Fat4 T C 3: 38,980,659 F2820S probably damaging Het
Fcho2 A G 13: 98,789,463 I132T probably benign Het
Garnl3 A G 2: 32,995,078 V810A probably damaging Het
Gm14403 A C 2: 177,509,525 Q179P probably damaging Het
Gm3127 A G 14: 4,172,501 M251V probably benign Het
Hook3 A G 8: 26,071,086 S298P probably benign Het
Impact T A 18: 12,986,313 probably null Het
Itgal T C 7: 127,330,213 F1101L probably benign Het
Itih1 C T 14: 30,934,107 R579Q probably null Het
Kansl2 T C 15: 98,529,544 probably null Het
Kng1 A G 16: 23,079,641 D597G probably benign Het
Kpna1 A G 16: 36,015,962 probably benign Het
Ltbp1 G T 17: 75,291,366 C614F probably damaging Het
Luc7l3 T C 11: 94,299,984 E168G unknown Het
Lvrn A C 18: 46,881,322 K525T probably benign Het
Mdn1 G A 4: 32,719,184 R2249H probably damaging Het
Mmp16 G T 4: 18,110,550 G449C probably damaging Het
Mst1r T C 9: 107,908,193 V350A probably benign Het
Muc5b A G 7: 141,864,017 M3567V probably benign Het
Mybl1 A T 1: 9,678,288 L361Q probably damaging Het
Myom1 T A 17: 71,089,947 S1063R probably benign Het
Notch4 A C 17: 34,572,693 H582P probably benign Het
Nwd2 T A 5: 63,807,494 C1474S probably benign Het
Olfr1163 A C 2: 88,070,577 N268K probably benign Het
Olfr1284 A T 2: 111,379,879 D293V probably damaging Het
Olfr1338 A T 4: 118,753,851 I231N probably damaging Het
Olfr889 G T 9: 38,116,663 S294I probably damaging Het
Pcmt1 A T 10: 7,638,182 V241D probably damaging Het
Plcl1 T A 1: 55,697,463 N654K probably damaging Het
Plg G A 17: 12,388,559 G121D probably damaging Het
Ptch1 A G 13: 63,512,060 S1260P probably benign Het
Pwp1 G T 10: 85,884,537 R346I probably damaging Het
R3hdm1 C T 1: 128,216,495 T800I probably benign Het
Rab3gap2 A G 1: 185,204,297 D19G possibly damaging Het
Slc1a3 G T 15: 8,645,902 N206K possibly damaging Het
Slc6a3 T C 13: 73,571,472 V540A probably benign Het
Sntb1 G A 15: 55,791,265 P265S probably benign Het
Timm29 T C 9: 21,593,453 V139A probably damaging Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tm2d3 T A 7: 65,693,926 V56E probably benign Het
Trhr2 T A 8: 122,360,537 T55S probably damaging Het
Trim17 T G 11: 58,968,578 V206G probably benign Het
Trpm1 A G 7: 64,268,697 N1479S probably benign Het
Trpv2 T A 11: 62,583,088 C190S probably benign Het
Umod A T 7: 119,478,326 probably benign Het
Usp34 T A 11: 23,464,585 Y2862N Het
Vmn1r158 A G 7: 22,790,676 V36A possibly damaging Het
Zfp420 A G 7: 29,875,366 Y337C probably damaging Het
Other mutations in Lama2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Lama2 APN 10 27188265 missense probably benign 0.01
IGL00467:Lama2 APN 10 27467197 splice site probably benign
IGL00470:Lama2 APN 10 27243742 missense probably benign 0.22
IGL00517:Lama2 APN 10 27197330 missense probably benign 0.01
IGL00541:Lama2 APN 10 27188306 missense probably benign 0.14
IGL00931:Lama2 APN 10 27006776 missense possibly damaging 0.92
IGL00951:Lama2 APN 10 27030285 missense probably benign 0.03
IGL00988:Lama2 APN 10 27369015 nonsense probably null
IGL01098:Lama2 APN 10 27031112 missense possibly damaging 0.66
IGL01152:Lama2 APN 10 27208429 missense probably benign 0.00
IGL01293:Lama2 APN 10 27231636 missense probably benign 0.38
IGL01338:Lama2 APN 10 27188272 missense probably benign 0.13
IGL01609:Lama2 APN 10 27344421 missense probably benign 0.03
IGL01643:Lama2 APN 10 27070372 splice site probably benign
IGL01675:Lama2 APN 10 27188054 missense possibly damaging 0.77
IGL01681:Lama2 APN 10 27265045 missense probably benign 0.33
IGL01694:Lama2 APN 10 27006742 missense possibly damaging 0.75
IGL01705:Lama2 APN 10 27189274 splice site probably benign
IGL01885:Lama2 APN 10 27105139 nonsense probably null
IGL01935:Lama2 APN 10 27422604 missense probably damaging 0.98
IGL01994:Lama2 APN 10 27467203 critical splice donor site probably null
IGL02041:Lama2 APN 10 26984326 missense probably damaging 1.00
IGL02067:Lama2 APN 10 27176796 missense probably benign 0.02
IGL02097:Lama2 APN 10 27138960 missense probably benign 0.09
IGL02179:Lama2 APN 10 27070364 missense probably benign 0.01
IGL02268:Lama2 APN 10 27001116 splice site probably benign
IGL02302:Lama2 APN 10 27212043 missense probably benign 0.06
IGL02363:Lama2 APN 10 27366066 missense probably damaging 1.00
IGL02378:Lama2 APN 10 27043656 missense probably damaging 0.99
IGL02642:Lama2 APN 10 27467273 missense probably damaging 1.00
IGL02676:Lama2 APN 10 27118493 missense probably benign 0.00
IGL02695:Lama2 APN 10 27000775 missense probably benign
IGL02735:Lama2 APN 10 27104128 missense probably damaging 1.00
IGL02794:Lama2 APN 10 27041231 missense possibly damaging 0.73
IGL02823:Lama2 APN 10 27001145 missense probably damaging 1.00
IGL02869:Lama2 APN 10 27015538 missense probably damaging 0.99
IGL02942:Lama2 APN 10 27041220 missense probably damaging 1.00
IGL03201:Lama2 APN 10 27344570 nonsense probably null
IGL03268:Lama2 APN 10 27422653 missense probably damaging 1.00
IGL03288:Lama2 APN 10 27369051 missense probably damaging 1.00
IGL03380:Lama2 APN 10 27050265 missense probably damaging 1.00
IGL03407:Lama2 APN 10 27347021 missense probably damaging 1.00
cowboy UTSW 10 27043643 frame shift probably null
petri UTSW 10 26993398 splice site probably null
PIT4362001:Lama2 UTSW 10 27369136 missense probably damaging 1.00
PIT4382001:Lama2 UTSW 10 27204905 missense probably damaging 1.00
PIT4431001:Lama2 UTSW 10 27101430 missense probably damaging 1.00
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0114:Lama2 UTSW 10 26993068 nonsense probably null
R0142:Lama2 UTSW 10 27187845 missense probably benign
R0313:Lama2 UTSW 10 26993398 splice site probably null
R0376:Lama2 UTSW 10 27015546 missense possibly damaging 0.68
R0412:Lama2 UTSW 10 27190625 missense possibly damaging 0.58
R0472:Lama2 UTSW 10 26990867 missense probably damaging 1.00
R0607:Lama2 UTSW 10 27189131 missense probably benign 0.34
R0648:Lama2 UTSW 10 26989376 missense probably benign 0.00
R0667:Lama2 UTSW 10 27344410 splice site probably null
R0760:Lama2 UTSW 10 27044433 critical splice donor site probably null
R1240:Lama2 UTSW 10 27041124 missense probably damaging 1.00
R1385:Lama2 UTSW 10 27224043 missense probably benign 0.11
R1433:Lama2 UTSW 10 27187754 missense probably damaging 1.00
R1434:Lama2 UTSW 10 27208370 missense probably damaging 1.00
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1645:Lama2 UTSW 10 27368985 missense probably damaging 1.00
R1702:Lama2 UTSW 10 27190529 missense probably benign
R1703:Lama2 UTSW 10 27266671 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208406 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208407 missense probably benign
R1846:Lama2 UTSW 10 27212096 missense probably damaging 1.00
R1859:Lama2 UTSW 10 27031082 missense possibly damaging 0.51
R1871:Lama2 UTSW 10 26984494 missense probably damaging 1.00
R1903:Lama2 UTSW 10 27188399 missense probably damaging 1.00
R1906:Lama2 UTSW 10 27056527 critical splice donor site probably null
R1958:Lama2 UTSW 10 26981598 missense probably damaging 0.97
R1959:Lama2 UTSW 10 27422618 missense probably damaging 1.00
R1977:Lama2 UTSW 10 26990800 splice site probably null
R2063:Lama2 UTSW 10 27164926 missense probably damaging 1.00
R2079:Lama2 UTSW 10 27369053 missense probably damaging 0.99
R2085:Lama2 UTSW 10 27204841 nonsense probably null
R2125:Lama2 UTSW 10 27044453 nonsense probably null
R2140:Lama2 UTSW 10 27054694 splice site probably null
R2219:Lama2 UTSW 10 27043569 missense probably damaging 0.99
R2259:Lama2 UTSW 10 27031127 missense probably benign 0.00
R2265:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2266:Lama2 UTSW 10 26986797 missense probably benign 0.02
R2267:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2268:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2269:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2862:Lama2 UTSW 10 27422612 nonsense probably null
R2912:Lama2 UTSW 10 27000803 missense probably benign
R2999:Lama2 UTSW 10 26989421 missense probably benign 0.18
R3034:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3081:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3107:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3109:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3436:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3437:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3706:Lama2 UTSW 10 27138996 missense probably damaging 1.00
R3780:Lama2 UTSW 10 27459339 missense probably damaging 1.00
R3807:Lama2 UTSW 10 27190665 frame shift probably null
R3919:Lama2 UTSW 10 27118505 missense probably damaging 1.00
R4014:Lama2 UTSW 10 26984376 missense probably damaging 1.00
R4131:Lama2 UTSW 10 27041174 missense probably benign 0.00
R4190:Lama2 UTSW 10 27266664 missense probably damaging 0.96
R4273:Lama2 UTSW 10 27347054 missense probably damaging 1.00
R4358:Lama2 UTSW 10 26984493 missense probably damaging 1.00
R4407:Lama2 UTSW 10 27212128 small deletion probably benign
R4415:Lama2 UTSW 10 26989344 nonsense probably null
R4426:Lama2 UTSW 10 27422558 missense probably damaging 1.00
R4590:Lama2 UTSW 10 26989414 missense probably benign 0.00
R4615:Lama2 UTSW 10 26981524 missense probably damaging 0.99
R4736:Lama2 UTSW 10 27204929 missense probably damaging 1.00
R4754:Lama2 UTSW 10 27118531 missense possibly damaging 0.58
R4791:Lama2 UTSW 10 27467271 missense probably damaging 1.00
R4834:Lama2 UTSW 10 27006749 missense probably benign 0.30
R4856:Lama2 UTSW 10 27043643 frame shift probably null
R4858:Lama2 UTSW 10 27043643 frame shift probably null
R4859:Lama2 UTSW 10 27043643 frame shift probably null
R4897:Lama2 UTSW 10 27043643 frame shift probably null
R4898:Lama2 UTSW 10 27043643 frame shift probably null
R4899:Lama2 UTSW 10 27043643 frame shift probably null
R4907:Lama2 UTSW 10 27164946 missense probably benign 0.11
R4911:Lama2 UTSW 10 27138927 missense probably damaging 1.00
R4924:Lama2 UTSW 10 27369141 missense probably damaging 0.98
R5023:Lama2 UTSW 10 27190504 missense probably damaging 0.97
R5057:Lama2 UTSW 10 27164986 missense probably damaging 1.00
R5070:Lama2 UTSW 10 27350251 critical splice donor site probably null
R5116:Lama2 UTSW 10 27118560 missense probably benign 0.08
R5177:Lama2 UTSW 10 27190703 missense possibly damaging 0.94
R5198:Lama2 UTSW 10 27347003 missense probably damaging 0.96
R5289:Lama2 UTSW 10 27212073 nonsense probably null
R5327:Lama2 UTSW 10 27138946 missense probably benign
R5424:Lama2 UTSW 10 26984396 missense probably damaging 1.00
R5469:Lama2 UTSW 10 27041189 missense possibly damaging 0.92
R5620:Lama2 UTSW 10 26990880 missense probably damaging 0.99
R5667:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5671:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5815:Lama2 UTSW 10 26986851 missense probably damaging 1.00
R5917:Lama2 UTSW 10 27190697 missense probably damaging 1.00
R5935:Lama2 UTSW 10 27015498 missense probably benign
R5976:Lama2 UTSW 10 27190676 missense probably benign 0.00
R5979:Lama2 UTSW 10 27235732 missense probably damaging 0.99
R6004:Lama2 UTSW 10 27235785 missense probably benign 0.01
R6180:Lama2 UTSW 10 26981499 missense probably benign 0.03
R6198:Lama2 UTSW 10 27188022 missense probably damaging 1.00
R6257:Lama2 UTSW 10 26986899 missense possibly damaging 0.85
R6271:Lama2 UTSW 10 27023329 missense possibly damaging 0.67
R6322:Lama2 UTSW 10 27190547 missense probably damaging 0.96
R6354:Lama2 UTSW 10 27212068 missense probably damaging 1.00
R6431:Lama2 UTSW 10 27053031 missense possibly damaging 0.50
R6499:Lama2 UTSW 10 27031158 missense probably damaging 1.00
R6535:Lama2 UTSW 10 27104131 missense probably damaging 1.00
R6545:Lama2 UTSW 10 27176797 missense probably benign
R6636:Lama2 UTSW 10 27124568 missense probably benign 0.13
R6891:Lama2 UTSW 10 27328072 nonsense probably null
R6891:Lama2 UTSW 10 27328082 nonsense probably null
R6902:Lama2 UTSW 10 26981629 missense probably damaging 1.00
R6908:Lama2 UTSW 10 27031196 splice site probably null
R7233:Lama2 UTSW 10 27231663 missense probably damaging 1.00
R7272:Lama2 UTSW 10 27124556 missense probably damaging 1.00
R7274:Lama2 UTSW 10 27119980 missense probably damaging 0.99
R7419:Lama2 UTSW 10 27266634 missense probably benign
R7423:Lama2 UTSW 10 27212226 missense probably benign 0.00
R7554:Lama2 UTSW 10 27155496 missense probably damaging 1.00
R7569:Lama2 UTSW 10 27265050 missense probably damaging 1.00
R7574:Lama2 UTSW 10 27006730 missense probably benign 0.03
R7584:Lama2 UTSW 10 27104261 missense possibly damaging 0.78
R7586:Lama2 UTSW 10 27101393 missense probably benign 0.00
R7603:Lama2 UTSW 10 27266680 missense possibly damaging 0.55
R7691:Lama2 UTSW 10 27208393 missense possibly damaging 0.67
R7750:Lama2 UTSW 10 26990924 missense probably damaging 0.97
R7841:Lama2 UTSW 10 27155533 missense probably benign 0.00
R7864:Lama2 UTSW 10 27056615 missense probably benign 0.08
R7960:Lama2 UTSW 10 26993098 missense probably benign 0.04
R7964:Lama2 UTSW 10 27223981 critical splice donor site probably null
R7980:Lama2 UTSW 10 27363613 missense probably damaging 0.98
R8013:Lama2 UTSW 10 27344498 missense probably benign 0.00
R8028:Lama2 UTSW 10 27328149 missense probably benign 0.13
R8097:Lama2 UTSW 10 27190664 nonsense probably null
R8100:Lama2 UTSW 10 27041117 missense probably benign 0.03
R8110:Lama2 UTSW 10 26990870 missense probably damaging 1.00
R8122:Lama2 UTSW 10 27054596 missense possibly damaging 0.87
R8264:Lama2 UTSW 10 27467222 missense probably benign 0.07
R8315:Lama2 UTSW 10 27422659 missense probably damaging 1.00
R8318:Lama2 UTSW 10 26984338 missense probably damaging 1.00
R8419:Lama2 UTSW 10 27422563 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AGCATCTAAGTGGCGACCTG -3'
(R):5'- GGTGGGCATGTAGCATACATTG -3'

Sequencing Primer
(F):5'- GGCGACCTGACACTCATTC -3'
(R):5'- TTAAGGAAGCCTGAAGGCA -3'
Posted On2019-06-26