Incidental Mutation 'R7168:Pwp1'
ID558068
Institutional Source Beutler Lab
Gene Symbol Pwp1
Ensembl Gene ENSMUSG00000001785
Gene NamePWP1 homolog, endonuclein
Synonyms2610205J09Rik, 2310058A11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7168 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location85829494-85889096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 85884537 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Isoleucine at position 346 (R346I)
Ref Sequence ENSEMBL: ENSMUSP00000001836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001836] [ENSMUST00000219256]
Predicted Effect probably damaging
Transcript: ENSMUST00000001836
AA Change: R346I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001836
Gene: ENSMUSG00000001785
AA Change: R346I

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Blast:WD40 168 220 4e-27 BLAST
WD40 244 284 4.51e-7 SMART
WD40 287 327 3.37e-6 SMART
WD40 331 370 4.42e1 SMART
WD40 373 413 6.38e-7 SMART
Blast:WD40 418 458 3e-23 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000219256
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains several WD-40 repeats and is found mostly in the nucleus. The expression and localization of this protein are cell cycle dependent. Expression of this gene is upregulated in pancreatic adenocarcinoma. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,216,057 D1388V probably damaging Het
2810474O19Rik T G 6: 149,327,843 F796V probably benign Het
2900026A02Rik C A 5: 113,137,793 R65L probably damaging Het
Abcb10 A T 8: 123,966,611 L318Q Het
Abhd18 T A 3: 40,934,936 V417D probably damaging Het
Actl7a A G 4: 56,743,769 K99E probably benign Het
Adam2 A T 14: 66,058,792 I206N possibly damaging Het
Adgrv1 G T 13: 81,397,209 S5652R possibly damaging Het
Aebp2 C T 6: 140,633,700 T221M probably damaging Het
Ahi1 T A 10: 21,017,932 M854K probably benign Het
Alpi T A 1: 87,099,433 T375S possibly damaging Het
Apip T A 2: 103,092,468 C210* probably null Het
Arid3b A T 9: 57,805,535 D232E probably benign Het
Asic5 G A 3: 82,011,975 C342Y probably damaging Het
BC035947 T C 1: 78,499,593 M101V probably benign Het
Brd3 G A 2: 27,454,399 R440C possibly damaging Het
Deaf1 C T 7: 141,324,596 probably benign Het
Eif2ak3 A G 6: 70,881,626 T300A probably benign Het
Eml6 T A 11: 29,838,529 I519F probably benign Het
Fat4 T C 3: 38,980,659 F2820S probably damaging Het
Fcho2 A G 13: 98,789,463 I132T probably benign Het
Garnl3 A G 2: 32,995,078 V810A probably damaging Het
Gm14403 A C 2: 177,509,525 Q179P probably damaging Het
Gm3127 A G 14: 4,172,501 M251V probably benign Het
Hook3 A G 8: 26,071,086 S298P probably benign Het
Impact T A 18: 12,986,313 probably null Het
Itgal T C 7: 127,330,213 F1101L probably benign Het
Itih1 C T 14: 30,934,107 R579Q probably null Het
Kansl2 T C 15: 98,529,544 probably null Het
Kng1 A G 16: 23,079,641 D597G probably benign Het
Kpna1 A G 16: 36,015,962 probably benign Het
Lama2 C T 10: 27,366,152 probably null Het
Ltbp1 G T 17: 75,291,366 C614F probably damaging Het
Luc7l3 T C 11: 94,299,984 E168G unknown Het
Lvrn A C 18: 46,881,322 K525T probably benign Het
Mdn1 G A 4: 32,719,184 R2249H probably damaging Het
Mmp16 G T 4: 18,110,550 G449C probably damaging Het
Mst1r T C 9: 107,908,193 V350A probably benign Het
Muc5b A G 7: 141,864,017 M3567V probably benign Het
Mybl1 A T 1: 9,678,288 L361Q probably damaging Het
Myom1 T A 17: 71,089,947 S1063R probably benign Het
Notch4 A C 17: 34,572,693 H582P probably benign Het
Nwd2 T A 5: 63,807,494 C1474S probably benign Het
Olfr1163 A C 2: 88,070,577 N268K probably benign Het
Olfr1284 A T 2: 111,379,879 D293V probably damaging Het
Olfr1338 A T 4: 118,753,851 I231N probably damaging Het
Olfr889 G T 9: 38,116,663 S294I probably damaging Het
Pcmt1 A T 10: 7,638,182 V241D probably damaging Het
Plcl1 T A 1: 55,697,463 N654K probably damaging Het
Plg G A 17: 12,388,559 G121D probably damaging Het
Ptch1 A G 13: 63,512,060 S1260P probably benign Het
R3hdm1 C T 1: 128,216,495 T800I probably benign Het
Rab3gap2 A G 1: 185,204,297 D19G possibly damaging Het
Slc1a3 G T 15: 8,645,902 N206K possibly damaging Het
Slc6a3 T C 13: 73,571,472 V540A probably benign Het
Sntb1 G A 15: 55,791,265 P265S probably benign Het
Timm29 T C 9: 21,593,453 V139A probably damaging Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tm2d3 T A 7: 65,693,926 V56E probably benign Het
Trhr2 T A 8: 122,360,537 T55S probably damaging Het
Trim17 T G 11: 58,968,578 V206G probably benign Het
Trpm1 A G 7: 64,268,697 N1479S probably benign Het
Trpv2 T A 11: 62,583,088 C190S probably benign Het
Umod A T 7: 119,478,326 probably benign Het
Usp34 T A 11: 23,464,585 Y2862N Het
Vmn1r158 A G 7: 22,790,676 V36A possibly damaging Het
Zfp420 A G 7: 29,875,366 Y337C probably damaging Het
Other mutations in Pwp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00707:Pwp1 APN 10 85878516 missense probably damaging 1.00
IGL00778:Pwp1 APN 10 85879888 missense probably benign 0.05
IGL01086:Pwp1 APN 10 85879893 splice site probably null
IGL02526:Pwp1 APN 10 85882103 splice site probably null
IGL02596:Pwp1 APN 10 85872018 splice site probably null
IGL03164:Pwp1 APN 10 85878503 missense probably benign 0.19
IGL03269:Pwp1 APN 10 85882904 missense probably damaging 0.98
Annuals UTSW 10 85876514 missense probably damaging 1.00
R0031:Pwp1 UTSW 10 85885896 missense probably benign 0.20
R0049:Pwp1 UTSW 10 85885616 missense possibly damaging 0.67
R0049:Pwp1 UTSW 10 85885616 missense possibly damaging 0.67
R0766:Pwp1 UTSW 10 85879309 missense probably damaging 0.98
R0926:Pwp1 UTSW 10 85876514 missense probably damaging 1.00
R1238:Pwp1 UTSW 10 85885862 missense probably benign 0.02
R1312:Pwp1 UTSW 10 85879309 missense probably damaging 0.98
R1420:Pwp1 UTSW 10 85876538 missense probably damaging 1.00
R3177:Pwp1 UTSW 10 85882079 missense probably benign 0.45
R3277:Pwp1 UTSW 10 85882079 missense probably benign 0.45
R3818:Pwp1 UTSW 10 85888129 missense possibly damaging 0.76
R4008:Pwp1 UTSW 10 85882034 missense possibly damaging 0.60
R5964:Pwp1 UTSW 10 85882886 missense probably damaging 1.00
R6252:Pwp1 UTSW 10 85874509 missense probably benign 0.00
R6280:Pwp1 UTSW 10 85874462 missense probably damaging 0.99
R6765:Pwp1 UTSW 10 85884533 missense probably damaging 0.99
R7213:Pwp1 UTSW 10 85876309 missense probably benign
R7236:Pwp1 UTSW 10 85879283 missense probably benign 0.00
R7840:Pwp1 UTSW 10 85888050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATCCGCCAGTGAGCGTC -3'
(R):5'- AGCCCAATGGAATAGTTGAAAATTAGC -3'

Sequencing Primer
(F):5'- TCTCTGCAAGAGGAGCAAGTTCTC -3'
(R):5'- CATCACACTAGCAGAGAAAATG -3'
Posted On2019-06-26