Incidental Mutation 'R7168:Adgrv1'
ID 558077
Institutional Source Beutler Lab
Gene Symbol Adgrv1
Ensembl Gene ENSMUSG00000069170
Gene Name adhesion G protein-coupled receptor V1
Synonyms Mass1, Mgr1, VLGR1, Gpr98
MMRRC Submission 045263-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7168 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 81243187-81781273 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 81545328 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 5652 (S5652R)
Ref Sequence ENSEMBL: ENSMUSP00000093245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095585]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000095585
AA Change: S5652R

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000093245
Gene: ENSMUSG00000069170
AA Change: S5652R

DomainStartEndE-ValueType
Calx_beta 20 116 1.53e-1 SMART
Calx_beta 132 236 1.58e-2 SMART
Calx_beta 251 362 2.33e-2 SMART
Pfam:Calx-beta 380 489 1.1e-3 PFAM
Pfam:Calx-beta 507 616 2.5e-2 PFAM
Pfam:Calx-beta 667 747 9.1e-4 PFAM
Calx_beta 764 862 1.55e-1 SMART
Calx_beta 877 980 1.07e-1 SMART
Calx_beta 994 1094 6.45e-5 SMART
Pfam:Calx-beta 1108 1208 7.4e-4 PFAM
Pfam:Laminin_G_3 1331 1492 4.4e-24 PFAM
Pfam:Calx-beta 1498 1542 6.5e-3 PFAM
Pfam:Calx-beta 1557 1662 1e-6 PFAM
Calx_beta 1706 1805 1.34e-11 SMART
Calx_beta 1846 1948 1.04e-2 SMART
Calx_beta 1962 2075 1.59e-3 SMART
Calx_beta 2103 2202 1.59e-4 SMART
Calx_beta 2218 2320 1.74e-3 SMART
Pfam:Calx-beta 2467 2539 2.1e-4 PFAM
Calx_beta 2576 2672 1.24e-6 SMART
Calx_beta 2687 2786 1.12e-1 SMART
Calx_beta 2810 2921 2.21e-2 SMART
Calx_beta 2945 3044 6.69e-12 SMART
Pfam:Calx-beta 3063 3168 1.2e-5 PFAM
Pfam:Calx-beta 3198 3252 1.2e-1 PFAM
Pfam:EPTP 3391 3434 2.8e-10 PFAM
Pfam:Calx-beta 3577 3623 6.5e-8 PFAM
Pfam:Calx-beta 3637 3737 6e-4 PFAM
Pfam:Calx-beta 3781 3872 6.9e-3 PFAM
Calx_beta 3919 4003 1.18e-2 SMART
Calx_beta 4017 4120 5.44e-2 SMART
Pfam:Calx-beta 4193 4236 2.3e-2 PFAM
Calx_beta 4251 4351 1.43e-20 SMART
Calx_beta 4384 4484 9.46e-3 SMART
Pfam:Calx-beta 4498 4608 2e-2 PFAM
Pfam:Calx-beta 4659 4729 5.1e-2 PFAM
Calx_beta 4989 5089 5.7e-6 SMART
Pfam:Calx-beta 5229 5326 1.9e-6 PFAM
Pfam:Calx-beta 5489 5592 7.2e-5 PFAM
low complexity region 5637 5648 N/A INTRINSIC
GPS 5845 5895 9.48e-3 SMART
Pfam:7tm_2 5902 6141 2.3e-16 PFAM
low complexity region 6227 6240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125698
SMART Domains Protein: ENSMUSP00000120136
Gene: ENSMUSG00000069170

DomainStartEndE-ValueType
Pfam:Calx-beta 1 47 2e-9 PFAM
Pfam:Calx-beta 79 180 4e-11 PFAM
Pfam:Calx-beta 194 304 9.2e-4 PFAM
Pfam:Calx-beta 354 425 2.9e-3 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor superfamily. The encoded protein contains a 7-transmembrane receptor domain, binds calcium and is expressed in the central nervous system. Mutations in this gene are associated with Usher syndrome 2 and familial febrile seizures. Several alternatively spliced transcripts have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous and a targeted mutation exhibit high sensitivity to audiogenic seizures. Targeted mutant mice lack the ankle links that connect growing stereocilia in the developing cochlear hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,262,831 (GRCm39) D1388V probably damaging Het
2900026A02Rik C A 5: 113,285,659 (GRCm39) R65L probably damaging Het
Abcb10 A T 8: 124,693,350 (GRCm39) L318Q Het
Abhd18 T A 3: 40,889,371 (GRCm39) V417D probably damaging Het
Actl7a A G 4: 56,743,769 (GRCm39) K99E probably benign Het
Adam2 A T 14: 66,296,241 (GRCm39) I206N possibly damaging Het
Aebp2 C T 6: 140,579,426 (GRCm39) T221M probably damaging Het
Ahi1 T A 10: 20,893,831 (GRCm39) M854K probably benign Het
Alpi T A 1: 87,027,155 (GRCm39) T375S possibly damaging Het
Apip T A 2: 102,922,813 (GRCm39) C210* probably null Het
Arid3b A T 9: 57,712,818 (GRCm39) D232E probably benign Het
Asic5 G A 3: 81,919,282 (GRCm39) C342Y probably damaging Het
BC035947 T C 1: 78,476,230 (GRCm39) M101V probably benign Het
Brd3 G A 2: 27,344,411 (GRCm39) R440C possibly damaging Het
Deaf1 C T 7: 140,904,509 (GRCm39) probably benign Het
Eif2ak3 A G 6: 70,858,610 (GRCm39) T300A probably benign Het
Eml6 T A 11: 29,788,529 (GRCm39) I519F probably benign Het
Fat4 T C 3: 39,034,808 (GRCm39) F2820S probably damaging Het
Fcho2 A G 13: 98,925,971 (GRCm39) I132T probably benign Het
Garnl3 A G 2: 32,885,090 (GRCm39) V810A probably damaging Het
Gm14403 A C 2: 177,201,318 (GRCm39) Q179P probably damaging Het
Gm3127 A G 14: 15,432,250 (GRCm39) M251V probably benign Het
Hook3 A G 8: 26,561,114 (GRCm39) S298P probably benign Het
Impact T A 18: 13,119,370 (GRCm39) probably null Het
Itgal T C 7: 126,929,385 (GRCm39) F1101L probably benign Het
Itih1 C T 14: 30,656,064 (GRCm39) R579Q probably null Het
Kansl2 T C 15: 98,427,425 (GRCm39) probably null Het
Kng1 A G 16: 22,898,391 (GRCm39) D597G probably benign Het
Kpna1 A G 16: 35,836,332 (GRCm39) probably benign Het
Lama2 C T 10: 27,242,148 (GRCm39) probably null Het
Ltbp1 G T 17: 75,598,361 (GRCm39) C614F probably damaging Het
Luc7l3 T C 11: 94,190,810 (GRCm39) E168G unknown Het
Lvrn A C 18: 47,014,389 (GRCm39) K525T probably benign Het
Mdn1 G A 4: 32,719,184 (GRCm39) R2249H probably damaging Het
Mmp16 G T 4: 18,110,550 (GRCm39) G449C probably damaging Het
Mst1r T C 9: 107,785,392 (GRCm39) V350A probably benign Het
Muc5b A G 7: 141,417,754 (GRCm39) M3567V probably benign Het
Mybl1 A T 1: 9,748,513 (GRCm39) L361Q probably damaging Het
Myom1 T A 17: 71,396,942 (GRCm39) S1063R probably benign Het
Notch4 A C 17: 34,791,667 (GRCm39) H582P probably benign Het
Nwd2 T A 5: 63,964,837 (GRCm39) C1474S probably benign Het
Or10ak14 A T 4: 118,611,048 (GRCm39) I231N probably damaging Het
Or4g17 A T 2: 111,210,224 (GRCm39) D293V probably damaging Het
Or5d36 A C 2: 87,900,921 (GRCm39) N268K probably benign Het
Or8b40 G T 9: 38,027,959 (GRCm39) S294I probably damaging Het
Pcmt1 A T 10: 7,513,946 (GRCm39) V241D probably damaging Het
Plcl1 T A 1: 55,736,622 (GRCm39) N654K probably damaging Het
Plg G A 17: 12,607,446 (GRCm39) G121D probably damaging Het
Ptch1 A G 13: 63,659,874 (GRCm39) S1260P probably benign Het
Pwp1 G T 10: 85,720,401 (GRCm39) R346I probably damaging Het
R3hdm1 C T 1: 128,144,232 (GRCm39) T800I probably benign Het
Rab3gap2 A G 1: 184,936,494 (GRCm39) D19G possibly damaging Het
Resf1 T G 6: 149,229,341 (GRCm39) F796V probably benign Het
Slc1a3 G T 15: 8,675,386 (GRCm39) N206K possibly damaging Het
Slc6a3 T C 13: 73,719,591 (GRCm39) V540A probably benign Het
Sntb1 G A 15: 55,654,661 (GRCm39) P265S probably benign Het
Timm29 T C 9: 21,504,749 (GRCm39) V139A probably damaging Het
Tktl2 A G 8: 66,965,753 (GRCm39) E437G probably damaging Het
Tm2d3 T A 7: 65,343,674 (GRCm39) V56E probably benign Het
Trhr2 T A 8: 123,087,276 (GRCm39) T55S probably damaging Het
Trim17 T G 11: 58,859,404 (GRCm39) V206G probably benign Het
Trpm1 A G 7: 63,918,445 (GRCm39) N1479S probably benign Het
Trpv2 T A 11: 62,473,914 (GRCm39) C190S probably benign Het
Umod A T 7: 119,077,549 (GRCm39) probably benign Het
Usp34 T A 11: 23,414,585 (GRCm39) Y2862N Het
Vmn1r158 A G 7: 22,490,101 (GRCm39) V36A possibly damaging Het
Zfp420 A G 7: 29,574,791 (GRCm39) Y337C probably damaging Het
Other mutations in Adgrv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgrv1 APN 13 81,553,527 (GRCm39) critical splice acceptor site probably null
IGL00090:Adgrv1 APN 13 81,726,220 (GRCm39) missense probably damaging 1.00
IGL00091:Adgrv1 APN 13 81,726,220 (GRCm39) missense probably damaging 1.00
IGL00332:Adgrv1 APN 13 81,620,996 (GRCm39) splice site probably benign
IGL00471:Adgrv1 APN 13 81,657,661 (GRCm39) missense probably damaging 0.99
IGL00476:Adgrv1 APN 13 81,637,193 (GRCm39) missense probably damaging 0.98
IGL00508:Adgrv1 APN 13 81,654,306 (GRCm39) missense probably damaging 1.00
IGL00727:Adgrv1 APN 13 81,672,803 (GRCm39) missense probably damaging 0.98
IGL00781:Adgrv1 APN 13 81,726,349 (GRCm39) missense probably benign 0.19
IGL00816:Adgrv1 APN 13 81,545,322 (GRCm39) missense probably benign 0.01
IGL00844:Adgrv1 APN 13 81,688,238 (GRCm39) missense probably damaging 1.00
IGL00923:Adgrv1 APN 13 81,530,410 (GRCm39) missense probably damaging 0.99
IGL01113:Adgrv1 APN 13 81,637,147 (GRCm39) missense probably benign 0.00
IGL01143:Adgrv1 APN 13 81,567,470 (GRCm39) missense probably benign 0.00
IGL01151:Adgrv1 APN 13 81,553,518 (GRCm39) missense probably benign 0.00
IGL01153:Adgrv1 APN 13 81,567,247 (GRCm39) missense probably benign 0.01
IGL01363:Adgrv1 APN 13 81,705,184 (GRCm39) missense probably damaging 1.00
IGL01419:Adgrv1 APN 13 81,705,277 (GRCm39) missense probably damaging 0.99
IGL01545:Adgrv1 APN 13 81,614,303 (GRCm39) missense possibly damaging 0.46
IGL01701:Adgrv1 APN 13 81,567,750 (GRCm39) missense possibly damaging 0.55
IGL01796:Adgrv1 APN 13 81,715,461 (GRCm39) missense probably benign 0.01
IGL01816:Adgrv1 APN 13 81,677,168 (GRCm39) missense probably benign 0.00
IGL01871:Adgrv1 APN 13 81,620,513 (GRCm39) critical splice donor site probably null
IGL01955:Adgrv1 APN 13 81,330,902 (GRCm39) missense probably damaging 1.00
IGL01956:Adgrv1 APN 13 81,594,549 (GRCm39) missense possibly damaging 0.63
IGL01988:Adgrv1 APN 13 81,705,428 (GRCm39) missense probably damaging 0.99
IGL01990:Adgrv1 APN 13 81,705,115 (GRCm39) missense probably damaging 1.00
IGL02007:Adgrv1 APN 13 81,716,862 (GRCm39) splice site probably benign
IGL02016:Adgrv1 APN 13 81,545,572 (GRCm39) missense probably damaging 1.00
IGL02095:Adgrv1 APN 13 81,727,909 (GRCm39) missense possibly damaging 0.63
IGL02174:Adgrv1 APN 13 81,575,783 (GRCm39) missense probably benign 0.34
IGL02270:Adgrv1 APN 13 81,707,314 (GRCm39) splice site probably null
IGL02328:Adgrv1 APN 13 81,726,294 (GRCm39) missense probably damaging 1.00
IGL02350:Adgrv1 APN 13 81,418,974 (GRCm39) missense probably benign 0.00
IGL02357:Adgrv1 APN 13 81,418,974 (GRCm39) missense probably benign 0.00
IGL02373:Adgrv1 APN 13 81,607,832 (GRCm39) missense possibly damaging 0.90
IGL02402:Adgrv1 APN 13 81,707,543 (GRCm39) missense probably benign 0.18
IGL02407:Adgrv1 APN 13 81,627,789 (GRCm39) missense probably damaging 1.00
IGL02508:Adgrv1 APN 13 81,583,675 (GRCm39) splice site probably benign
IGL02603:Adgrv1 APN 13 81,637,071 (GRCm39) missense possibly damaging 0.93
IGL02648:Adgrv1 APN 13 81,659,738 (GRCm39) missense probably benign 0.35
IGL02720:Adgrv1 APN 13 81,726,991 (GRCm39) missense probably damaging 0.99
IGL02870:Adgrv1 APN 13 81,711,851 (GRCm39) missense probably benign 0.13
IGL02896:Adgrv1 APN 13 81,668,858 (GRCm39) missense probably damaging 1.00
IGL02931:Adgrv1 APN 13 81,727,833 (GRCm39) missense probably damaging 1.00
IGL02952:Adgrv1 APN 13 81,581,755 (GRCm39) missense probably benign 0.00
IGL02961:Adgrv1 APN 13 81,671,731 (GRCm39) missense probably damaging 1.00
IGL02999:Adgrv1 APN 13 81,726,973 (GRCm39) missense probably benign 0.12
IGL03067:Adgrv1 APN 13 81,590,599 (GRCm39) missense probably damaging 1.00
IGL03106:Adgrv1 APN 13 81,621,018 (GRCm39) missense probably benign 0.00
IGL03108:Adgrv1 APN 13 81,707,648 (GRCm39) missense probably damaging 1.00
IGL03119:Adgrv1 APN 13 81,581,819 (GRCm39) missense probably benign 0.02
IGL03119:Adgrv1 APN 13 81,530,492 (GRCm39) missense probably damaging 1.00
IGL03169:Adgrv1 APN 13 81,652,019 (GRCm39) missense probably damaging 1.00
IGL03186:Adgrv1 APN 13 81,581,737 (GRCm39) missense possibly damaging 0.80
IGL03196:Adgrv1 APN 13 81,594,597 (GRCm39) missense probably benign 0.02
IGL03207:Adgrv1 APN 13 81,255,017 (GRCm39) splice site probably null
IGL03343:Adgrv1 APN 13 81,431,507 (GRCm39) missense probably damaging 1.00
IGL03348:Adgrv1 APN 13 81,647,177 (GRCm39) missense possibly damaging 0.54
IGL03349:Adgrv1 APN 13 81,629,455 (GRCm39) missense probably benign 0.09
IGL03373:Adgrv1 APN 13 81,711,751 (GRCm39) missense probably damaging 0.99
IGL03381:Adgrv1 APN 13 81,666,086 (GRCm39) missense probably damaging 0.99
abetting UTSW 13 81,727,679 (GRCm39) missense probably damaging 1.00
beatle UTSW 13 81,727,713 (GRCm39) nonsense probably null
Escape UTSW 13 81,583,824 (GRCm39) missense probably benign 0.02
lento UTSW 13 81,419,016 (GRCm39) missense probably damaging 1.00
Metronome UTSW 13 81,583,678 (GRCm39) critical splice donor site probably null
Murderous UTSW 13 81,251,443 (GRCm39) missense possibly damaging 0.94
Nome UTSW 13 81,539,886 (GRCm39) missense probably benign 0.00
Propulsion UTSW 13 81,623,166 (GRCm39) missense probably benign 0.06
revulsion UTSW 13 81,743,301 (GRCm39) missense probably damaging 1.00
Saturnv UTSW 13 81,679,795 (GRCm39) missense probably damaging 1.00
Thrust UTSW 13 81,522,375 (GRCm39) missense probably benign 0.01
Velocity UTSW 13 81,545,473 (GRCm39) missense probably benign 0.00
Wilting UTSW 13 81,640,620 (GRCm39) missense probably benign 0.02
Withering UTSW 13 81,642,776 (GRCm39) missense probably damaging 1.00
F2404:Adgrv1 UTSW 13 81,568,125 (GRCm39) missense probably benign 0.13
G1patch:Adgrv1 UTSW 13 81,641,329 (GRCm39) missense probably damaging 1.00
G1patch:Adgrv1 UTSW 13 81,585,676 (GRCm39) missense probably damaging 0.99
I2288:Adgrv1 UTSW 13 81,585,643 (GRCm39) missense probably damaging 1.00
I2289:Adgrv1 UTSW 13 81,585,643 (GRCm39) missense probably damaging 1.00
PIT4377001:Adgrv1 UTSW 13 81,677,104 (GRCm39) missense probably damaging 1.00
PIT4504001:Adgrv1 UTSW 13 81,707,471 (GRCm39) missense probably damaging 0.99
R0017:Adgrv1 UTSW 13 81,727,065 (GRCm39) missense probably benign 0.13
R0017:Adgrv1 UTSW 13 81,727,065 (GRCm39) missense probably benign 0.13
R0058:Adgrv1 UTSW 13 81,330,791 (GRCm39) missense possibly damaging 0.65
R0058:Adgrv1 UTSW 13 81,330,791 (GRCm39) missense possibly damaging 0.65
R0083:Adgrv1 UTSW 13 81,726,523 (GRCm39) unclassified probably benign
R0087:Adgrv1 UTSW 13 81,535,070 (GRCm39) missense probably damaging 1.00
R0108:Adgrv1 UTSW 13 81,726,523 (GRCm39) unclassified probably benign
R0131:Adgrv1 UTSW 13 81,651,114 (GRCm39) unclassified probably benign
R0218:Adgrv1 UTSW 13 81,255,017 (GRCm39) splice site probably null
R0325:Adgrv1 UTSW 13 81,688,134 (GRCm39) missense probably damaging 1.00
R0326:Adgrv1 UTSW 13 81,623,112 (GRCm39) missense possibly damaging 0.46
R0395:Adgrv1 UTSW 13 81,534,072 (GRCm39) missense probably benign 0.00
R0441:Adgrv1 UTSW 13 81,545,345 (GRCm39) nonsense probably null
R0466:Adgrv1 UTSW 13 81,714,415 (GRCm39) missense probably benign 0.00
R0487:Adgrv1 UTSW 13 81,637,154 (GRCm39) missense probably damaging 1.00
R0501:Adgrv1 UTSW 13 81,707,269 (GRCm39) missense probably damaging 1.00
R0522:Adgrv1 UTSW 13 81,676,561 (GRCm39) splice site probably benign
R0532:Adgrv1 UTSW 13 81,727,015 (GRCm39) missense probably damaging 1.00
R0542:Adgrv1 UTSW 13 81,721,437 (GRCm39) missense probably damaging 1.00
R0681:Adgrv1 UTSW 13 81,676,649 (GRCm39) missense probably damaging 1.00
R0689:Adgrv1 UTSW 13 81,623,224 (GRCm39) missense possibly damaging 0.47
R0732:Adgrv1 UTSW 13 81,651,123 (GRCm39) missense possibly damaging 0.86
R0746:Adgrv1 UTSW 13 81,718,675 (GRCm39) missense probably benign 0.10
R0763:Adgrv1 UTSW 13 81,647,244 (GRCm39) missense probably damaging 0.98
R0846:Adgrv1 UTSW 13 81,627,861 (GRCm39) nonsense probably null
R0962:Adgrv1 UTSW 13 81,553,465 (GRCm39) missense probably benign 0.01
R1146:Adgrv1 UTSW 13 81,679,795 (GRCm39) missense probably damaging 1.00
R1146:Adgrv1 UTSW 13 81,679,795 (GRCm39) missense probably damaging 1.00
R1172:Adgrv1 UTSW 13 81,705,182 (GRCm39) missense probably damaging 0.98
R1178:Adgrv1 UTSW 13 81,588,156 (GRCm39) splice site probably benign
R1310:Adgrv1 UTSW 13 81,714,496 (GRCm39) missense probably benign 0.09
R1386:Adgrv1 UTSW 13 81,676,984 (GRCm39) missense probably benign 0.17
R1387:Adgrv1 UTSW 13 81,641,295 (GRCm39) missense possibly damaging 0.62
R1395:Adgrv1 UTSW 13 81,534,907 (GRCm39) missense probably benign 0.05
R1412:Adgrv1 UTSW 13 81,243,569 (GRCm39) missense probably damaging 1.00
R1448:Adgrv1 UTSW 13 81,581,632 (GRCm39) missense probably benign 0.08
R1470:Adgrv1 UTSW 13 81,530,417 (GRCm39) missense probably benign 0.03
R1470:Adgrv1 UTSW 13 81,530,417 (GRCm39) missense probably benign 0.03
R1485:Adgrv1 UTSW 13 81,727,738 (GRCm39) missense probably damaging 1.00
R1507:Adgrv1 UTSW 13 81,620,699 (GRCm39) critical splice acceptor site probably null
R1513:Adgrv1 UTSW 13 81,705,076 (GRCm39) missense probably damaging 1.00
R1513:Adgrv1 UTSW 13 81,741,167 (GRCm39) missense probably damaging 1.00
R1539:Adgrv1 UTSW 13 81,652,097 (GRCm39) splice site probably null
R1579:Adgrv1 UTSW 13 81,711,898 (GRCm39) missense probably damaging 1.00
R1580:Adgrv1 UTSW 13 81,614,279 (GRCm39) critical splice donor site probably null
R1611:Adgrv1 UTSW 13 81,707,236 (GRCm39) missense probably damaging 1.00
R1615:Adgrv1 UTSW 13 81,572,407 (GRCm39) missense probably benign 0.41
R1651:Adgrv1 UTSW 13 81,635,972 (GRCm39) missense probably benign 0.19
R1660:Adgrv1 UTSW 13 81,624,750 (GRCm39) missense probably benign 0.00
R1679:Adgrv1 UTSW 13 81,707,671 (GRCm39) missense probably damaging 1.00
R1709:Adgrv1 UTSW 13 81,741,179 (GRCm39) missense probably damaging 1.00
R1735:Adgrv1 UTSW 13 81,636,066 (GRCm39) missense possibly damaging 0.62
R1762:Adgrv1 UTSW 13 81,654,265 (GRCm39) missense probably benign 0.08
R1830:Adgrv1 UTSW 13 81,637,196 (GRCm39) missense possibly damaging 0.65
R1836:Adgrv1 UTSW 13 81,652,232 (GRCm39) missense probably benign 0.01
R1843:Adgrv1 UTSW 13 81,692,652 (GRCm39) missense probably damaging 1.00
R1863:Adgrv1 UTSW 13 81,711,685 (GRCm39) missense probably damaging 1.00
R1895:Adgrv1 UTSW 13 81,522,368 (GRCm39) missense probably damaging 1.00
R1907:Adgrv1 UTSW 13 81,740,670 (GRCm39) splice site probably benign
R1928:Adgrv1 UTSW 13 81,668,905 (GRCm39) missense probably benign 0.00
R1938:Adgrv1 UTSW 13 81,539,876 (GRCm39) missense probably damaging 0.99
R1944:Adgrv1 UTSW 13 81,659,030 (GRCm39) missense probably damaging 1.00
R1946:Adgrv1 UTSW 13 81,522,368 (GRCm39) missense probably damaging 1.00
R1984:Adgrv1 UTSW 13 81,671,868 (GRCm39) missense probably damaging 1.00
R2027:Adgrv1 UTSW 13 81,743,301 (GRCm39) missense probably damaging 1.00
R2063:Adgrv1 UTSW 13 81,709,588 (GRCm39) missense possibly damaging 0.81
R2116:Adgrv1 UTSW 13 81,677,132 (GRCm39) missense probably benign 0.11
R2117:Adgrv1 UTSW 13 81,640,656 (GRCm39) missense probably benign 0.00
R2125:Adgrv1 UTSW 13 81,568,069 (GRCm39) missense probably benign 0.02
R2125:Adgrv1 UTSW 13 81,567,654 (GRCm39) missense probably benign 0.00
R2127:Adgrv1 UTSW 13 81,705,199 (GRCm39) missense probably damaging 1.00
R2128:Adgrv1 UTSW 13 81,705,199 (GRCm39) missense probably damaging 1.00
R2129:Adgrv1 UTSW 13 81,705,199 (GRCm39) missense probably damaging 1.00
R2130:Adgrv1 UTSW 13 81,729,846 (GRCm39) missense possibly damaging 0.61
R2135:Adgrv1 UTSW 13 81,672,676 (GRCm39) critical splice donor site probably null
R2138:Adgrv1 UTSW 13 81,593,439 (GRCm39) missense probably benign 0.00
R2166:Adgrv1 UTSW 13 81,716,762 (GRCm39) missense probably damaging 1.00
R2171:Adgrv1 UTSW 13 81,419,037 (GRCm39) missense probably damaging 1.00
R2191:Adgrv1 UTSW 13 81,714,409 (GRCm39) missense possibly damaging 0.90
R2256:Adgrv1 UTSW 13 81,654,259 (GRCm39) missense probably benign
R2260:Adgrv1 UTSW 13 81,716,493 (GRCm39) missense probably damaging 0.97
R2323:Adgrv1 UTSW 13 81,743,298 (GRCm39) missense probably damaging 1.00
R2432:Adgrv1 UTSW 13 81,688,251 (GRCm39) frame shift probably null
R2910:Adgrv1 UTSW 13 81,705,238 (GRCm39) missense possibly damaging 0.61
R2920:Adgrv1 UTSW 13 81,596,984 (GRCm39) missense probably benign 0.01
R2989:Adgrv1 UTSW 13 81,729,866 (GRCm39) missense probably damaging 1.00
R3402:Adgrv1 UTSW 13 81,691,661 (GRCm39) missense probably damaging 1.00
R3692:Adgrv1 UTSW 13 81,672,719 (GRCm39) missense possibly damaging 0.91
R3711:Adgrv1 UTSW 13 81,567,594 (GRCm39) missense probably benign 0.02
R3732:Adgrv1 UTSW 13 81,705,075 (GRCm39) missense probably damaging 1.00
R3732:Adgrv1 UTSW 13 81,705,075 (GRCm39) missense probably damaging 1.00
R3733:Adgrv1 UTSW 13 81,705,075 (GRCm39) missense probably damaging 1.00
R3773:Adgrv1 UTSW 13 81,647,162 (GRCm39) missense probably damaging 0.98
R3791:Adgrv1 UTSW 13 81,741,221 (GRCm39) missense probably damaging 1.00
R3794:Adgrv1 UTSW 13 81,431,486 (GRCm39) start codon destroyed probably damaging 1.00
R3848:Adgrv1 UTSW 13 81,588,191 (GRCm39) missense probably damaging 0.97
R3880:Adgrv1 UTSW 13 81,583,824 (GRCm39) missense probably benign 0.02
R3925:Adgrv1 UTSW 13 81,726,891 (GRCm39) missense possibly damaging 0.89
R3934:Adgrv1 UTSW 13 81,623,166 (GRCm39) missense probably benign 0.06
R3942:Adgrv1 UTSW 13 81,330,908 (GRCm39) missense probably damaging 1.00
R4002:Adgrv1 UTSW 13 81,688,251 (GRCm39) frame shift probably null
R4003:Adgrv1 UTSW 13 81,688,251 (GRCm39) frame shift probably null
R4194:Adgrv1 UTSW 13 81,647,115 (GRCm39) missense probably damaging 0.98
R4308:Adgrv1 UTSW 13 81,588,311 (GRCm39) missense probably damaging 0.96
R4368:Adgrv1 UTSW 13 81,641,029 (GRCm39) missense unknown
R4388:Adgrv1 UTSW 13 81,729,828 (GRCm39) missense probably damaging 0.98
R4421:Adgrv1 UTSW 13 81,714,421 (GRCm39) missense probably damaging 1.00
R4468:Adgrv1 UTSW 13 81,522,375 (GRCm39) missense probably benign 0.01
R4483:Adgrv1 UTSW 13 81,567,349 (GRCm39) missense probably benign 0.01
R4487:Adgrv1 UTSW 13 81,588,185 (GRCm39) missense probably damaging 0.99
R4566:Adgrv1 UTSW 13 81,567,927 (GRCm39) missense probably damaging 1.00
R4615:Adgrv1 UTSW 13 81,642,688 (GRCm39) splice site probably null
R4647:Adgrv1 UTSW 13 81,676,914 (GRCm39) nonsense probably null
R4657:Adgrv1 UTSW 13 81,553,483 (GRCm39) missense probably benign 0.01
R4723:Adgrv1 UTSW 13 81,581,644 (GRCm39) missense probably benign 0.02
R4765:Adgrv1 UTSW 13 81,255,038 (GRCm39) missense probably damaging 0.99
R4783:Adgrv1 UTSW 13 81,243,564 (GRCm39) missense probably damaging 0.99
R4796:Adgrv1 UTSW 13 81,303,350 (GRCm39) nonsense probably null
R4816:Adgrv1 UTSW 13 81,676,793 (GRCm39) missense probably damaging 1.00
R4833:Adgrv1 UTSW 13 81,708,963 (GRCm39) missense possibly damaging 0.81
R4841:Adgrv1 UTSW 13 81,651,120 (GRCm39) critical splice donor site probably null
R4871:Adgrv1 UTSW 13 81,681,241 (GRCm39) intron probably benign
R4897:Adgrv1 UTSW 13 81,709,704 (GRCm39) splice site probably null
R4906:Adgrv1 UTSW 13 81,418,857 (GRCm39) splice site probably null
R4917:Adgrv1 UTSW 13 81,658,996 (GRCm39) missense probably benign 0.30
R4996:Adgrv1 UTSW 13 81,726,853 (GRCm39) missense probably benign 0.01
R5030:Adgrv1 UTSW 13 81,607,948 (GRCm39) missense probably benign 0.43
R5044:Adgrv1 UTSW 13 81,637,050 (GRCm39) missense probably benign 0.01
R5052:Adgrv1 UTSW 13 81,676,940 (GRCm39) missense probably damaging 0.97
R5093:Adgrv1 UTSW 13 81,740,704 (GRCm39) missense probably damaging 1.00
R5095:Adgrv1 UTSW 13 81,243,606 (GRCm39) missense probably benign 0.00
R5119:Adgrv1 UTSW 13 81,567,546 (GRCm39) missense possibly damaging 0.93
R5133:Adgrv1 UTSW 13 81,587,560 (GRCm39) missense probably damaging 1.00
R5141:Adgrv1 UTSW 13 81,419,037 (GRCm39) missense probably damaging 1.00
R5164:Adgrv1 UTSW 13 81,583,793 (GRCm39) missense probably benign 0.00
R5180:Adgrv1 UTSW 13 81,431,535 (GRCm39) start gained probably benign
R5203:Adgrv1 UTSW 13 81,659,024 (GRCm39) missense possibly damaging 0.91
R5241:Adgrv1 UTSW 13 81,637,048 (GRCm39) nonsense probably null
R5280:Adgrv1 UTSW 13 81,545,584 (GRCm39) missense possibly damaging 0.95
R5289:Adgrv1 UTSW 13 81,669,203 (GRCm39) missense probably benign 0.04
R5304:Adgrv1 UTSW 13 81,726,372 (GRCm39) missense possibly damaging 0.93
R5310:Adgrv1 UTSW 13 81,624,809 (GRCm39) missense possibly damaging 0.95
R5338:Adgrv1 UTSW 13 81,677,165 (GRCm39) missense possibly damaging 0.80
R5352:Adgrv1 UTSW 13 81,642,776 (GRCm39) missense probably damaging 1.00
R5402:Adgrv1 UTSW 13 81,607,834 (GRCm39) missense probably benign 0.25
R5418:Adgrv1 UTSW 13 81,567,427 (GRCm39) missense probably benign 0.01
R5460:Adgrv1 UTSW 13 81,572,377 (GRCm39) missense possibly damaging 0.95
R5510:Adgrv1 UTSW 13 81,593,363 (GRCm39) missense probably damaging 1.00
R5521:Adgrv1 UTSW 13 81,567,508 (GRCm39) missense probably benign 0.01
R5538:Adgrv1 UTSW 13 81,581,808 (GRCm39) missense probably benign 0.02
R5561:Adgrv1 UTSW 13 81,624,683 (GRCm39) missense probably damaging 0.99
R5584:Adgrv1 UTSW 13 81,553,386 (GRCm39) missense probably damaging 1.00
R5608:Adgrv1 UTSW 13 81,303,395 (GRCm39) missense probably damaging 1.00
R5610:Adgrv1 UTSW 13 81,669,236 (GRCm39) missense probably damaging 1.00
R5619:Adgrv1 UTSW 13 81,620,619 (GRCm39) missense probably damaging 1.00
R5751:Adgrv1 UTSW 13 81,670,355 (GRCm39) missense probably damaging 1.00
R5832:Adgrv1 UTSW 13 81,251,421 (GRCm39) missense possibly damaging 0.95
R5885:Adgrv1 UTSW 13 81,572,390 (GRCm39) missense probably benign 0.15
R5930:Adgrv1 UTSW 13 81,545,570 (GRCm39) missense probably benign 0.06
R5937:Adgrv1 UTSW 13 81,255,194 (GRCm39) missense probably damaging 0.96
R5943:Adgrv1 UTSW 13 81,534,985 (GRCm39) missense probably damaging 0.98
R5951:Adgrv1 UTSW 13 81,590,620 (GRCm39) missense probably damaging 1.00
R5977:Adgrv1 UTSW 13 81,583,678 (GRCm39) critical splice donor site probably null
R5995:Adgrv1 UTSW 13 81,614,378 (GRCm39) missense probably benign 0.03
R6017:Adgrv1 UTSW 13 81,545,542 (GRCm39) nonsense probably null
R6024:Adgrv1 UTSW 13 81,624,624 (GRCm39) missense probably benign 0.26
R6049:Adgrv1 UTSW 13 81,545,473 (GRCm39) missense probably benign 0.00
R6108:Adgrv1 UTSW 13 81,539,814 (GRCm39) missense probably damaging 0.99
R6130:Adgrv1 UTSW 13 81,575,864 (GRCm39) missense probably damaging 0.99
R6132:Adgrv1 UTSW 13 81,654,195 (GRCm39) missense probably benign 0.04
R6149:Adgrv1 UTSW 13 81,330,893 (GRCm39) missense probably damaging 1.00
R6169:Adgrv1 UTSW 13 81,567,378 (GRCm39) missense probably benign 0.00
R6175:Adgrv1 UTSW 13 81,534,124 (GRCm39) missense probably damaging 1.00
R6184:Adgrv1 UTSW 13 81,581,957 (GRCm39) missense probably benign 0.01
R6190:Adgrv1 UTSW 13 81,672,898 (GRCm39) splice site probably null
R6190:Adgrv1 UTSW 13 81,607,882 (GRCm39) splice site probably null
R6215:Adgrv1 UTSW 13 81,727,713 (GRCm39) nonsense probably null
R6216:Adgrv1 UTSW 13 81,672,590 (GRCm39) splice site probably null
R6238:Adgrv1 UTSW 13 81,614,402 (GRCm39) missense probably benign 0.07
R6244:Adgrv1 UTSW 13 81,255,050 (GRCm39) missense probably damaging 1.00
R6298:Adgrv1 UTSW 13 81,539,886 (GRCm39) missense probably benign 0.00
R6316:Adgrv1 UTSW 13 81,647,187 (GRCm39) missense possibly damaging 0.63
R6336:Adgrv1 UTSW 13 81,534,100 (GRCm39) missense probably benign 0.09
R6358:Adgrv1 UTSW 13 81,562,702 (GRCm39) missense probably damaging 0.99
R6421:Adgrv1 UTSW 13 81,656,855 (GRCm39) missense possibly damaging 0.69
R6466:Adgrv1 UTSW 13 81,723,220 (GRCm39) splice site probably null
R6467:Adgrv1 UTSW 13 81,592,657 (GRCm39) missense probably benign 0.01
R6510:Adgrv1 UTSW 13 81,707,609 (GRCm39) missense possibly damaging 0.88
R6519:Adgrv1 UTSW 13 81,715,462 (GRCm39) missense probably benign 0.01
R6521:Adgrv1 UTSW 13 81,581,771 (GRCm39) missense probably damaging 1.00
R6598:Adgrv1 UTSW 13 81,654,298 (GRCm39) missense probably damaging 1.00
R6605:Adgrv1 UTSW 13 81,636,081 (GRCm39) missense possibly damaging 0.80
R6626:Adgrv1 UTSW 13 81,666,245 (GRCm39) missense probably damaging 1.00
R6633:Adgrv1 UTSW 13 81,716,762 (GRCm39) missense probably damaging 1.00
R6721:Adgrv1 UTSW 13 81,629,634 (GRCm39) missense probably benign 0.00
R6725:Adgrv1 UTSW 13 81,585,676 (GRCm39) missense probably damaging 0.99
R6725:Adgrv1 UTSW 13 81,641,329 (GRCm39) missense probably damaging 1.00
R6796:Adgrv1 UTSW 13 81,620,597 (GRCm39) missense probably damaging 1.00
R6809:Adgrv1 UTSW 13 81,621,072 (GRCm39) missense probably benign 0.01
R6823:Adgrv1 UTSW 13 81,705,200 (GRCm39) missense probably damaging 1.00
R6876:Adgrv1 UTSW 13 81,303,273 (GRCm39) critical splice donor site probably null
R6878:Adgrv1 UTSW 13 81,581,613 (GRCm39) missense probably benign 0.06
R6887:Adgrv1 UTSW 13 81,676,820 (GRCm39) missense probably benign 0.01
R6888:Adgrv1 UTSW 13 81,656,788 (GRCm39) missense probably damaging 1.00
R6957:Adgrv1 UTSW 13 81,715,609 (GRCm39) missense probably benign 0.00
R6976:Adgrv1 UTSW 13 81,669,116 (GRCm39) missense probably damaging 1.00
R7003:Adgrv1 UTSW 13 81,670,223 (GRCm39) critical splice donor site probably null
R7007:Adgrv1 UTSW 13 81,684,483 (GRCm39) missense possibly damaging 0.80
R7073:Adgrv1 UTSW 13 81,709,593 (GRCm39) missense probably damaging 1.00
R7100:Adgrv1 UTSW 13 81,419,016 (GRCm39) missense probably damaging 1.00
R7107:Adgrv1 UTSW 13 81,726,261 (GRCm39) missense probably benign 0.13
R7123:Adgrv1 UTSW 13 81,740,693 (GRCm39) missense probably damaging 1.00
R7141:Adgrv1 UTSW 13 81,640,620 (GRCm39) missense probably benign 0.02
R7205:Adgrv1 UTSW 13 81,627,777 (GRCm39) missense probably benign 0.00
R7239:Adgrv1 UTSW 13 81,624,731 (GRCm39) missense possibly damaging 0.69
R7249:Adgrv1 UTSW 13 81,522,378 (GRCm39) missense probably damaging 1.00
R7313:Adgrv1 UTSW 13 81,668,634 (GRCm39) missense possibly damaging 0.95
R7376:Adgrv1 UTSW 13 81,666,245 (GRCm39) missense probably damaging 1.00
R7392:Adgrv1 UTSW 13 81,708,808 (GRCm39) missense probably damaging 1.00
R7395:Adgrv1 UTSW 13 81,707,467 (GRCm39) missense probably damaging 1.00
R7410:Adgrv1 UTSW 13 81,711,738 (GRCm39) missense probably benign 0.04
R7449:Adgrv1 UTSW 13 81,647,192 (GRCm39) missense probably damaging 0.99
R7496:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7497:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7498:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7567:Adgrv1 UTSW 13 81,727,596 (GRCm39) missense probably damaging 1.00
R7567:Adgrv1 UTSW 13 81,581,648 (GRCm39) missense probably benign 0.00
R7614:Adgrv1 UTSW 13 81,668,780 (GRCm39) missense probably damaging 1.00
R7623:Adgrv1 UTSW 13 81,570,344 (GRCm39) missense possibly damaging 0.77
R7665:Adgrv1 UTSW 13 81,647,261 (GRCm39) missense probably damaging 1.00
R7685:Adgrv1 UTSW 13 81,251,443 (GRCm39) missense possibly damaging 0.94
R7788:Adgrv1 UTSW 13 81,721,433 (GRCm39) missense probably damaging 1.00
R7809:Adgrv1 UTSW 13 81,676,760 (GRCm39) missense possibly damaging 0.81
R7854:Adgrv1 UTSW 13 81,741,207 (GRCm39) missense probably damaging 1.00
R7894:Adgrv1 UTSW 13 81,715,570 (GRCm39) missense probably benign 0.00
R7948:Adgrv1 UTSW 13 81,707,707 (GRCm39) missense probably damaging 1.00
R7948:Adgrv1 UTSW 13 81,707,648 (GRCm39) missense probably damaging 1.00
R7949:Adgrv1 UTSW 13 81,303,353 (GRCm39) missense probably damaging 1.00
R7951:Adgrv1 UTSW 13 81,711,689 (GRCm39) missense probably damaging 1.00
R7968:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7969:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7973:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8007:Adgrv1 UTSW 13 81,431,585 (GRCm39) missense probably benign 0.04
R8018:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8044:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8050:Adgrv1 UTSW 13 81,561,296 (GRCm39) missense probably damaging 1.00
R8090:Adgrv1 UTSW 13 81,596,953 (GRCm39) critical splice donor site probably null
R8104:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8122:Adgrv1 UTSW 13 81,419,037 (GRCm39) missense probably damaging 1.00
R8122:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8123:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8125:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8126:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8212:Adgrv1 UTSW 13 81,670,240 (GRCm39) missense probably benign 0.01
R8221:Adgrv1 UTSW 13 81,677,033 (GRCm39) missense probably benign 0.00
R8256:Adgrv1 UTSW 13 81,727,679 (GRCm39) missense probably damaging 1.00
R8270:Adgrv1 UTSW 13 81,651,163 (GRCm39) missense probably damaging 0.96
R8290:Adgrv1 UTSW 13 81,630,002 (GRCm39) missense probably benign 0.00
R8298:Adgrv1 UTSW 13 81,534,033 (GRCm39) nonsense probably null
R8317:Adgrv1 UTSW 13 81,723,236 (GRCm39) missense probably damaging 0.98
R8326:Adgrv1 UTSW 13 81,593,462 (GRCm39) missense probably damaging 1.00
R8327:Adgrv1 UTSW 13 81,593,462 (GRCm39) missense probably damaging 1.00
R8330:Adgrv1 UTSW 13 81,593,462 (GRCm39) missense probably damaging 1.00
R8332:Adgrv1 UTSW 13 81,593,462 (GRCm39) missense probably damaging 1.00
R8345:Adgrv1 UTSW 13 81,251,505 (GRCm39) missense probably damaging 1.00
R8398:Adgrv1 UTSW 13 81,330,797 (GRCm39) missense probably damaging 1.00
R8399:Adgrv1 UTSW 13 81,637,289 (GRCm39) missense possibly damaging 0.55
R8450:Adgrv1 UTSW 13 81,583,962 (GRCm39) splice site probably null
R8471:Adgrv1 UTSW 13 81,594,591 (GRCm39) missense probably benign 0.00
R8534:Adgrv1 UTSW 13 81,534,887 (GRCm39) missense probably benign 0.02
R8537:Adgrv1 UTSW 13 81,684,491 (GRCm39) missense probably damaging 1.00
R8703:Adgrv1 UTSW 13 81,676,792 (GRCm39) missense probably damaging 1.00
R8845:Adgrv1 UTSW 13 81,629,478 (GRCm39) missense possibly damaging 0.79
R8846:Adgrv1 UTSW 13 81,637,025 (GRCm39) critical splice donor site probably null
R8849:Adgrv1 UTSW 13 81,669,324 (GRCm39) missense probably benign
R8856:Adgrv1 UTSW 13 81,707,621 (GRCm39) missense probably benign 0.11
R8915:Adgrv1 UTSW 13 81,715,558 (GRCm39) missense probably damaging 1.00
R8963:Adgrv1 UTSW 13 81,567,588 (GRCm39) missense probably benign
R8994:Adgrv1 UTSW 13 81,553,457 (GRCm39) frame shift probably null
R8995:Adgrv1 UTSW 13 81,553,457 (GRCm39) frame shift probably null
R8996:Adgrv1 UTSW 13 81,553,457 (GRCm39) frame shift probably null
R8997:Adgrv1 UTSW 13 81,553,457 (GRCm39) frame shift probably null
R9022:Adgrv1 UTSW 13 81,303,312 (GRCm39) missense probably damaging 1.00
R9059:Adgrv1 UTSW 13 81,562,692 (GRCm39) critical splice donor site probably null
R9076:Adgrv1 UTSW 13 81,570,247 (GRCm39) critical splice donor site probably null
R9119:Adgrv1 UTSW 13 81,658,995 (GRCm39) missense probably damaging 0.97
R9137:Adgrv1 UTSW 13 81,688,133 (GRCm39) missense probably damaging 1.00
R9146:Adgrv1 UTSW 13 81,561,291 (GRCm39) missense probably benign 0.11
R9156:Adgrv1 UTSW 13 81,669,302 (GRCm39) missense probably benign 0.00
R9163:Adgrv1 UTSW 13 81,567,541 (GRCm39) missense probably benign 0.19
R9282:Adgrv1 UTSW 13 81,251,491 (GRCm39) missense probably damaging 1.00
R9286:Adgrv1 UTSW 13 81,594,520 (GRCm39) missense probably damaging 0.98
R9328:Adgrv1 UTSW 13 81,620,523 (GRCm39) missense probably damaging 1.00
R9329:Adgrv1 UTSW 13 81,647,241 (GRCm39) missense probably damaging 1.00
R9350:Adgrv1 UTSW 13 81,654,274 (GRCm39) missense probably damaging 1.00
R9377:Adgrv1 UTSW 13 81,705,277 (GRCm39) missense probably damaging 0.99
R9394:Adgrv1 UTSW 13 81,624,767 (GRCm39) missense possibly damaging 0.95
R9419:Adgrv1 UTSW 13 81,656,887 (GRCm39) missense probably benign 0.44
R9427:Adgrv1 UTSW 13 81,732,234 (GRCm39) missense probably benign 0.00
R9429:Adgrv1 UTSW 13 81,741,165 (GRCm39) missense probably damaging 0.99
R9429:Adgrv1 UTSW 13 81,567,468 (GRCm39) missense probably damaging 1.00
R9433:Adgrv1 UTSW 13 81,714,471 (GRCm39) missense probably benign 0.02
R9434:Adgrv1 UTSW 13 81,666,292 (GRCm39) splice site probably benign
R9513:Adgrv1 UTSW 13 81,530,472 (GRCm39) missense possibly damaging 0.95
R9515:Adgrv1 UTSW 13 81,691,497 (GRCm39) missense probably damaging 0.99
R9523:Adgrv1 UTSW 13 81,567,178 (GRCm39) missense
R9525:Adgrv1 UTSW 13 81,593,453 (GRCm39) missense possibly damaging 0.77
R9576:Adgrv1 UTSW 13 81,691,608 (GRCm39) missense probably benign 0.06
R9612:Adgrv1 UTSW 13 81,641,082 (GRCm39) missense probably damaging 1.00
R9664:Adgrv1 UTSW 13 81,743,371 (GRCm39) missense probably damaging 1.00
R9664:Adgrv1 UTSW 13 81,670,288 (GRCm39) missense probably benign 0.01
R9702:Adgrv1 UTSW 13 81,684,483 (GRCm39) missense possibly damaging 0.80
R9717:Adgrv1 UTSW 13 81,668,900 (GRCm39) missense probably damaging 1.00
R9720:Adgrv1 UTSW 13 81,740,693 (GRCm39) missense probably damaging 1.00
X0054:Adgrv1 UTSW 13 81,707,389 (GRCm39) missense probably damaging 1.00
X0062:Adgrv1 UTSW 13 81,535,045 (GRCm39) missense probably damaging 0.99
X0067:Adgrv1 UTSW 13 81,691,511 (GRCm39) missense possibly damaging 0.51
Z1088:Adgrv1 UTSW 13 81,624,791 (GRCm39) missense probably damaging 1.00
Z1176:Adgrv1 UTSW 13 81,707,753 (GRCm39) missense possibly damaging 0.90
Z1177:Adgrv1 UTSW 13 81,567,375 (GRCm39) missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- GAGCAATGATGTCAAACAGGCC -3'
(R):5'- CCAAAAGGTGGTGCCAGAATTG -3'

Sequencing Primer
(F):5'- TGATGTCAAACAGGCCTTACTC -3'
(R):5'- TTGATAAAGTGTATGGGACTGCCAAC -3'
Posted On 2019-06-26