Incidental Mutation 'R7168:Itih1'
ID558080
Institutional Source Beutler Lab
Gene Symbol Itih1
Ensembl Gene ENSMUSG00000006529
Gene Nameinter-alpha trypsin inhibitor, heavy chain 1
Synonymsinter-alpha (globulin) inhibitor, H1 polypeptide, Itih-1, Intin1
MMRRC Submission
Accession Numbers

Genbank: NM_008406.3; Ensembl: ENSMUST00000163118

Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7168 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location30929180-30943289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30934107 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 579 (R579Q)
Ref Sequence ENSEMBL: ENSMUSP00000006704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006704] [ENSMUST00000163118]
Predicted Effect probably null
Transcript: ENSMUST00000006704
AA Change: R579Q

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006704
Gene: ENSMUSG00000006529
AA Change: R579Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VIT 34 167 6e-79 SMART
low complexity region 240 251 N/A INTRINSIC
VWA 291 472 2.1e-32 SMART
Blast:VWA 528 577 5e-21 BLAST
Pfam:ITI_HC_C 706 892 2.1e-65 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163118
AA Change: R575Q

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126449
Gene: ENSMUSG00000006529
AA Change: R575Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VIT 34 163 2.44e-80 SMART
low complexity region 236 247 N/A INTRINSIC
VWA 287 468 3.43e-30 SMART
Blast:VWA 524 573 5e-21 BLAST
Pfam:ITI_HC_C 701 888 5.3e-81 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes a heavy chain of inter-alpha trypsin inhibitor (IaI) family of plasma serine protease inhibitors. IaI proteins are protein-glycosaminoglycan-protein complexes comprised of two heavy chains and a light chain. The encoded protein covalently associates with the light chain via a chondroitin sulfate moiety. Intravenous administration of the encoded protein improved survival of mice after infection with Escherichia coli. This gene is located adjacent to two other IaI heavy chain genes. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing to generate mature protein. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,216,057 D1388V probably damaging Het
2810474O19Rik T G 6: 149,327,843 F796V probably benign Het
2900026A02Rik C A 5: 113,137,793 R65L probably damaging Het
Abcb10 A T 8: 123,966,611 L318Q Het
Abhd18 T A 3: 40,934,936 V417D probably damaging Het
Actl7a A G 4: 56,743,769 K99E probably benign Het
Adam2 A T 14: 66,058,792 I206N possibly damaging Het
Adgrv1 G T 13: 81,397,209 S5652R possibly damaging Het
Aebp2 C T 6: 140,633,700 T221M probably damaging Het
Ahi1 T A 10: 21,017,932 M854K probably benign Het
Alpi T A 1: 87,099,433 T375S possibly damaging Het
Apip T A 2: 103,092,468 C210* probably null Het
Arid3b A T 9: 57,805,535 D232E probably benign Het
Asic5 G A 3: 82,011,975 C342Y probably damaging Het
BC035947 T C 1: 78,499,593 M101V probably benign Het
Brd3 G A 2: 27,454,399 R440C possibly damaging Het
Deaf1 C T 7: 141,324,596 probably benign Het
Eif2ak3 A G 6: 70,881,626 T300A probably benign Het
Eml6 T A 11: 29,838,529 I519F probably benign Het
Fat4 T C 3: 38,980,659 F2820S probably damaging Het
Fcho2 A G 13: 98,789,463 I132T probably benign Het
Garnl3 A G 2: 32,995,078 V810A probably damaging Het
Gm14403 A C 2: 177,509,525 Q179P probably damaging Het
Gm3127 A G 14: 4,172,501 M251V probably benign Het
Hook3 A G 8: 26,071,086 S298P probably benign Het
Impact T A 18: 12,986,313 probably null Het
Itgal T C 7: 127,330,213 F1101L probably benign Het
Kansl2 T C 15: 98,529,544 probably null Het
Kng1 A G 16: 23,079,641 D597G probably benign Het
Kpna1 A G 16: 36,015,962 probably benign Het
Lama2 C T 10: 27,366,152 probably null Het
Ltbp1 G T 17: 75,291,366 C614F probably damaging Het
Luc7l3 T C 11: 94,299,984 E168G unknown Het
Lvrn A C 18: 46,881,322 K525T probably benign Het
Mdn1 G A 4: 32,719,184 R2249H probably damaging Het
Mmp16 G T 4: 18,110,550 G449C probably damaging Het
Mst1r T C 9: 107,908,193 V350A probably benign Het
Muc5b A G 7: 141,864,017 M3567V probably benign Het
Mybl1 A T 1: 9,678,288 L361Q probably damaging Het
Myom1 T A 17: 71,089,947 S1063R probably benign Het
Notch4 A C 17: 34,572,693 H582P probably benign Het
Nwd2 T A 5: 63,807,494 C1474S probably benign Het
Olfr1163 A C 2: 88,070,577 N268K probably benign Het
Olfr1284 A T 2: 111,379,879 D293V probably damaging Het
Olfr1338 A T 4: 118,753,851 I231N probably damaging Het
Olfr889 G T 9: 38,116,663 S294I probably damaging Het
Pcmt1 A T 10: 7,638,182 V241D probably damaging Het
Plcl1 T A 1: 55,697,463 N654K probably damaging Het
Plg G A 17: 12,388,559 G121D probably damaging Het
Ptch1 A G 13: 63,512,060 S1260P probably benign Het
Pwp1 G T 10: 85,884,537 R346I probably damaging Het
R3hdm1 C T 1: 128,216,495 T800I probably benign Het
Rab3gap2 A G 1: 185,204,297 D19G possibly damaging Het
Slc1a3 G T 15: 8,645,902 N206K possibly damaging Het
Slc6a3 T C 13: 73,571,472 V540A probably benign Het
Sntb1 G A 15: 55,791,265 P265S probably benign Het
Timm29 T C 9: 21,593,453 V139A probably damaging Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tm2d3 T A 7: 65,693,926 V56E probably benign Het
Trhr2 T A 8: 122,360,537 T55S probably damaging Het
Trim17 T G 11: 58,968,578 V206G probably benign Het
Trpm1 A G 7: 64,268,697 N1479S probably benign Het
Trpv2 T A 11: 62,583,088 C190S probably benign Het
Umod A T 7: 119,478,326 probably benign Het
Usp34 T A 11: 23,464,585 Y2862N Het
Vmn1r158 A G 7: 22,790,676 V36A possibly damaging Het
Zfp420 A G 7: 29,875,366 Y337C probably damaging Het
Other mutations in Itih1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Itih1 APN 14 30929821 missense probably benign 0.26
IGL00227:Itih1 APN 14 30942889 splice site probably null
IGL00902:Itih1 APN 14 30932482 splice site probably benign
IGL02194:Itih1 APN 14 30930365 missense probably benign 0.01
IGL02221:Itih1 APN 14 30929587 missense probably damaging 1.00
IGL02292:Itih1 APN 14 30933355 splice site probably null
IGL02733:Itih1 APN 14 30936720 missense probably damaging 1.00
IGL02928:Itih1 APN 14 30937758 missense probably damaging 1.00
IGL03064:Itih1 APN 14 30941557 missense probably benign 0.09
1mM(1):Itih1 UTSW 14 30929850 missense probably damaging 1.00
R0092:Itih1 UTSW 14 30940863 splice site probably benign
R0647:Itih1 UTSW 14 30935863 missense probably damaging 1.00
R0662:Itih1 UTSW 14 30933360 missense possibly damaging 0.63
R0744:Itih1 UTSW 14 30941555 missense probably damaging 1.00
R0833:Itih1 UTSW 14 30941555 missense probably damaging 1.00
R1070:Itih1 UTSW 14 30942456 splice site probably benign
R1397:Itih1 UTSW 14 30929905 splice site probably benign
R1797:Itih1 UTSW 14 30929899 missense probably damaging 1.00
R1898:Itih1 UTSW 14 30932287 missense probably benign
R1964:Itih1 UTSW 14 30929623 missense probably damaging 1.00
R1967:Itih1 UTSW 14 30941984 missense possibly damaging 0.67
R2086:Itih1 UTSW 14 30937843 missense probably damaging 1.00
R2155:Itih1 UTSW 14 30938071 missense probably damaging 1.00
R2156:Itih1 UTSW 14 30933475 missense possibly damaging 0.88
R2225:Itih1 UTSW 14 30929577 missense possibly damaging 0.88
R3836:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R3837:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R3839:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R4388:Itih1 UTSW 14 30941555 missense possibly damaging 0.93
R4504:Itih1 UTSW 14 30935885 missense probably damaging 1.00
R4618:Itih1 UTSW 14 30929831 missense probably benign 0.33
R4682:Itih1 UTSW 14 30937843 missense probably damaging 1.00
R4856:Itih1 UTSW 14 30936701 critical splice donor site probably null
R4886:Itih1 UTSW 14 30936701 critical splice donor site probably null
R5169:Itih1 UTSW 14 30933446 nonsense probably null
R5773:Itih1 UTSW 14 30935399 missense possibly damaging 0.89
R5875:Itih1 UTSW 14 30929530 missense probably benign
R6048:Itih1 UTSW 14 30929823 missense possibly damaging 0.89
R6077:Itih1 UTSW 14 30929876 missense possibly damaging 0.75
R6175:Itih1 UTSW 14 30931195 missense probably damaging 1.00
R6228:Itih1 UTSW 14 30931260 missense probably benign 0.00
R6664:Itih1 UTSW 14 30933436 missense probably damaging 1.00
R6675:Itih1 UTSW 14 30929841 missense possibly damaging 0.50
R7059:Itih1 UTSW 14 30931309 missense possibly damaging 0.93
R7408:Itih1 UTSW 14 30943160 missense probably benign 0.00
R7458:Itih1 UTSW 14 30943266 start codon destroyed probably null
R7717:Itih1 UTSW 14 30931185 missense probably damaging 1.00
R8016:Itih1 UTSW 14 30935294 missense probably damaging 0.96
R8035:Itih1 UTSW 14 30942525 missense probably benign 0.25
Z1177:Itih1 UTSW 14 30929572 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGGAACGTGCTCTGAGGAAG -3'
(R):5'- TGTACTGTCATGGCTTACGGC -3'

Sequencing Primer
(F):5'- CGTGCTCTGAGGAAGCTCAATG -3'
(R):5'- GCTTACGGCCTTGCTCC -3'
Posted On2019-06-26