Incidental Mutation 'R7168:Myom1'
ID 558087
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Name myomesin 1
Synonyms skelemin, D430047A17Rik
MMRRC Submission 045263-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7168 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 71326455-71433851 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 71396942 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 1063 (S1063R)
Ref Sequence ENSEMBL: ENSMUSP00000072945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
AlphaFold Q62234
PDB Structure Skelemin Immunoglobulin C2 like domain 4 [SOLUTION NMR]
Skelemin Association with alfa2b,betta3 Integrin: A Structural Model [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000024847
AA Change: S965R

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: S965R

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073211
AA Change: S1063R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: S1063R

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179759
AA Change: S965R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: S965R

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,262,831 (GRCm39) D1388V probably damaging Het
2900026A02Rik C A 5: 113,285,659 (GRCm39) R65L probably damaging Het
Abcb10 A T 8: 124,693,350 (GRCm39) L318Q Het
Abhd18 T A 3: 40,889,371 (GRCm39) V417D probably damaging Het
Actl7a A G 4: 56,743,769 (GRCm39) K99E probably benign Het
Adam2 A T 14: 66,296,241 (GRCm39) I206N possibly damaging Het
Adgrv1 G T 13: 81,545,328 (GRCm39) S5652R possibly damaging Het
Aebp2 C T 6: 140,579,426 (GRCm39) T221M probably damaging Het
Ahi1 T A 10: 20,893,831 (GRCm39) M854K probably benign Het
Alpi T A 1: 87,027,155 (GRCm39) T375S possibly damaging Het
Apip T A 2: 102,922,813 (GRCm39) C210* probably null Het
Arid3b A T 9: 57,712,818 (GRCm39) D232E probably benign Het
Asic5 G A 3: 81,919,282 (GRCm39) C342Y probably damaging Het
BC035947 T C 1: 78,476,230 (GRCm39) M101V probably benign Het
Brd3 G A 2: 27,344,411 (GRCm39) R440C possibly damaging Het
Deaf1 C T 7: 140,904,509 (GRCm39) probably benign Het
Eif2ak3 A G 6: 70,858,610 (GRCm39) T300A probably benign Het
Eml6 T A 11: 29,788,529 (GRCm39) I519F probably benign Het
Fat4 T C 3: 39,034,808 (GRCm39) F2820S probably damaging Het
Fcho2 A G 13: 98,925,971 (GRCm39) I132T probably benign Het
Garnl3 A G 2: 32,885,090 (GRCm39) V810A probably damaging Het
Gm14403 A C 2: 177,201,318 (GRCm39) Q179P probably damaging Het
Gm3127 A G 14: 15,432,250 (GRCm39) M251V probably benign Het
Hook3 A G 8: 26,561,114 (GRCm39) S298P probably benign Het
Impact T A 18: 13,119,370 (GRCm39) probably null Het
Itgal T C 7: 126,929,385 (GRCm39) F1101L probably benign Het
Itih1 C T 14: 30,656,064 (GRCm39) R579Q probably null Het
Kansl2 T C 15: 98,427,425 (GRCm39) probably null Het
Kng1 A G 16: 22,898,391 (GRCm39) D597G probably benign Het
Kpna1 A G 16: 35,836,332 (GRCm39) probably benign Het
Lama2 C T 10: 27,242,148 (GRCm39) probably null Het
Ltbp1 G T 17: 75,598,361 (GRCm39) C614F probably damaging Het
Luc7l3 T C 11: 94,190,810 (GRCm39) E168G unknown Het
Lvrn A C 18: 47,014,389 (GRCm39) K525T probably benign Het
Mdn1 G A 4: 32,719,184 (GRCm39) R2249H probably damaging Het
Mmp16 G T 4: 18,110,550 (GRCm39) G449C probably damaging Het
Mst1r T C 9: 107,785,392 (GRCm39) V350A probably benign Het
Muc5b A G 7: 141,417,754 (GRCm39) M3567V probably benign Het
Mybl1 A T 1: 9,748,513 (GRCm39) L361Q probably damaging Het
Notch4 A C 17: 34,791,667 (GRCm39) H582P probably benign Het
Nwd2 T A 5: 63,964,837 (GRCm39) C1474S probably benign Het
Or10ak14 A T 4: 118,611,048 (GRCm39) I231N probably damaging Het
Or4g17 A T 2: 111,210,224 (GRCm39) D293V probably damaging Het
Or5d36 A C 2: 87,900,921 (GRCm39) N268K probably benign Het
Or8b40 G T 9: 38,027,959 (GRCm39) S294I probably damaging Het
Pcmt1 A T 10: 7,513,946 (GRCm39) V241D probably damaging Het
Plcl1 T A 1: 55,736,622 (GRCm39) N654K probably damaging Het
Plg G A 17: 12,607,446 (GRCm39) G121D probably damaging Het
Ptch1 A G 13: 63,659,874 (GRCm39) S1260P probably benign Het
Pwp1 G T 10: 85,720,401 (GRCm39) R346I probably damaging Het
R3hdm1 C T 1: 128,144,232 (GRCm39) T800I probably benign Het
Rab3gap2 A G 1: 184,936,494 (GRCm39) D19G possibly damaging Het
Resf1 T G 6: 149,229,341 (GRCm39) F796V probably benign Het
Slc1a3 G T 15: 8,675,386 (GRCm39) N206K possibly damaging Het
Slc6a3 T C 13: 73,719,591 (GRCm39) V540A probably benign Het
Sntb1 G A 15: 55,654,661 (GRCm39) P265S probably benign Het
Timm29 T C 9: 21,504,749 (GRCm39) V139A probably damaging Het
Tktl2 A G 8: 66,965,753 (GRCm39) E437G probably damaging Het
Tm2d3 T A 7: 65,343,674 (GRCm39) V56E probably benign Het
Trhr2 T A 8: 123,087,276 (GRCm39) T55S probably damaging Het
Trim17 T G 11: 58,859,404 (GRCm39) V206G probably benign Het
Trpm1 A G 7: 63,918,445 (GRCm39) N1479S probably benign Het
Trpv2 T A 11: 62,473,914 (GRCm39) C190S probably benign Het
Umod A T 7: 119,077,549 (GRCm39) probably benign Het
Usp34 T A 11: 23,414,585 (GRCm39) Y2862N Het
Vmn1r158 A G 7: 22,490,101 (GRCm39) V36A possibly damaging Het
Zfp420 A G 7: 29,574,791 (GRCm39) Y337C probably damaging Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71,433,093 (GRCm39) missense probably damaging 1.00
IGL00845:Myom1 APN 17 71,391,424 (GRCm39) missense probably damaging 1.00
IGL00904:Myom1 APN 17 71,406,944 (GRCm39) splice site probably benign
IGL00928:Myom1 APN 17 71,396,908 (GRCm39) missense probably damaging 1.00
IGL01025:Myom1 APN 17 71,384,912 (GRCm39) missense probably damaging 1.00
IGL01548:Myom1 APN 17 71,408,215 (GRCm39) splice site probably benign
IGL01588:Myom1 APN 17 71,424,432 (GRCm39) missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71,433,173 (GRCm39) missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71,406,988 (GRCm39) missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71,351,471 (GRCm39) splice site probably benign
IGL01766:Myom1 APN 17 71,384,283 (GRCm39) missense probably damaging 1.00
IGL02105:Myom1 APN 17 71,354,711 (GRCm39) splice site probably benign
IGL02122:Myom1 APN 17 71,399,132 (GRCm39) missense probably damaging 1.00
IGL02184:Myom1 APN 17 71,379,132 (GRCm39) missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71,415,310 (GRCm39) nonsense probably null
IGL02486:Myom1 APN 17 71,406,939 (GRCm39) splice site probably benign
IGL02501:Myom1 APN 17 71,379,076 (GRCm39) critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71,408,093 (GRCm39) missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71,391,344 (GRCm39) missense probably damaging 1.00
IGL02719:Myom1 APN 17 71,413,349 (GRCm39) splice site probably benign
IGL02945:Myom1 APN 17 71,399,088 (GRCm39) splice site probably benign
IGL03086:Myom1 APN 17 71,415,666 (GRCm39) missense probably damaging 1.00
IGL03218:Myom1 APN 17 71,391,311 (GRCm39) missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71,384,360 (GRCm39) missense probably damaging 1.00
R0130:Myom1 UTSW 17 71,352,750 (GRCm39) missense probably damaging 0.98
R0133:Myom1 UTSW 17 71,354,782 (GRCm39) missense probably damaging 1.00
R0206:Myom1 UTSW 17 71,344,292 (GRCm39) missense probably damaging 1.00
R0206:Myom1 UTSW 17 71,344,292 (GRCm39) missense probably damaging 1.00
R0352:Myom1 UTSW 17 71,352,744 (GRCm39) missense possibly damaging 0.72
R0396:Myom1 UTSW 17 71,341,688 (GRCm39) missense probably damaging 1.00
R0496:Myom1 UTSW 17 71,391,301 (GRCm39) missense probably damaging 1.00
R0506:Myom1 UTSW 17 71,399,215 (GRCm39) splice site probably benign
R0511:Myom1 UTSW 17 71,391,312 (GRCm39) missense probably benign 0.22
R0600:Myom1 UTSW 17 71,427,643 (GRCm39) missense possibly damaging 0.48
R0699:Myom1 UTSW 17 71,374,308 (GRCm39) missense probably damaging 0.98
R0791:Myom1 UTSW 17 71,428,131 (GRCm39) missense probably damaging 1.00
R0792:Myom1 UTSW 17 71,428,131 (GRCm39) missense probably damaging 1.00
R0963:Myom1 UTSW 17 71,384,762 (GRCm39) missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71,359,714 (GRCm39) missense probably damaging 0.98
R2102:Myom1 UTSW 17 71,408,024 (GRCm39) missense probably damaging 1.00
R2158:Myom1 UTSW 17 71,371,592 (GRCm39) missense possibly damaging 0.83
R2336:Myom1 UTSW 17 71,330,189 (GRCm39) missense possibly damaging 0.53
R2351:Myom1 UTSW 17 71,341,574 (GRCm39) missense probably damaging 0.98
R2442:Myom1 UTSW 17 71,417,730 (GRCm39) missense probably damaging 1.00
R2483:Myom1 UTSW 17 71,384,807 (GRCm39) missense probably damaging 1.00
R2892:Myom1 UTSW 17 71,341,648 (GRCm39) missense probably damaging 1.00
R2897:Myom1 UTSW 17 71,408,215 (GRCm39) splice site probably benign
R3440:Myom1 UTSW 17 71,352,658 (GRCm39) splice site probably null
R3842:Myom1 UTSW 17 71,352,619 (GRCm39) missense probably damaging 1.00
R4249:Myom1 UTSW 17 71,399,135 (GRCm39) missense probably damaging 1.00
R4329:Myom1 UTSW 17 71,343,348 (GRCm39) missense probably damaging 1.00
R4594:Myom1 UTSW 17 71,407,069 (GRCm39) missense possibly damaging 0.73
R4873:Myom1 UTSW 17 71,379,114 (GRCm39) missense probably damaging 1.00
R4875:Myom1 UTSW 17 71,379,114 (GRCm39) missense probably damaging 1.00
R4876:Myom1 UTSW 17 71,384,405 (GRCm39) missense probably damaging 1.00
R5171:Myom1 UTSW 17 71,406,967 (GRCm39) missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71,416,782 (GRCm39) missense probably damaging 1.00
R5882:Myom1 UTSW 17 71,417,717 (GRCm39) missense probably damaging 1.00
R5978:Myom1 UTSW 17 71,424,438 (GRCm39) missense probably damaging 1.00
R6039:Myom1 UTSW 17 71,417,746 (GRCm39) missense probably damaging 1.00
R6039:Myom1 UTSW 17 71,417,746 (GRCm39) missense probably damaging 1.00
R6155:Myom1 UTSW 17 71,415,690 (GRCm39) critical splice donor site probably null
R6261:Myom1 UTSW 17 71,433,132 (GRCm39) missense probably damaging 1.00
R6284:Myom1 UTSW 17 71,329,887 (GRCm39) nonsense probably null
R6313:Myom1 UTSW 17 71,389,483 (GRCm39) missense probably benign
R6369:Myom1 UTSW 17 71,408,071 (GRCm39) missense probably damaging 1.00
R6545:Myom1 UTSW 17 71,389,300 (GRCm39) missense probably benign 0.00
R6738:Myom1 UTSW 17 71,407,393 (GRCm39) splice site probably null
R6933:Myom1 UTSW 17 71,359,666 (GRCm39) missense probably damaging 1.00
R7286:Myom1 UTSW 17 71,352,544 (GRCm39) missense possibly damaging 0.90
R7315:Myom1 UTSW 17 71,387,892 (GRCm39) critical splice donor site probably null
R7672:Myom1 UTSW 17 71,391,235 (GRCm39) missense possibly damaging 0.92
R7789:Myom1 UTSW 17 71,424,431 (GRCm39) missense probably benign 0.03
R7898:Myom1 UTSW 17 71,352,747 (GRCm39) missense probably benign 0.25
R8008:Myom1 UTSW 17 71,407,057 (GRCm39) missense probably benign 0.30
R8152:Myom1 UTSW 17 71,391,290 (GRCm39) missense probably damaging 0.96
R8554:Myom1 UTSW 17 71,343,448 (GRCm39) missense possibly damaging 0.94
R8874:Myom1 UTSW 17 71,413,199 (GRCm39) missense probably damaging 1.00
R8981:Myom1 UTSW 17 71,391,316 (GRCm39) missense probably benign 0.09
R9012:Myom1 UTSW 17 71,407,103 (GRCm39) missense probably benign 0.06
R9090:Myom1 UTSW 17 71,374,325 (GRCm39) missense probably damaging 1.00
R9193:Myom1 UTSW 17 71,343,295 (GRCm39) missense probably damaging 1.00
R9237:Myom1 UTSW 17 71,408,051 (GRCm39) missense probably damaging 1.00
R9271:Myom1 UTSW 17 71,374,325 (GRCm39) missense probably damaging 1.00
R9355:Myom1 UTSW 17 71,384,888 (GRCm39) missense probably damaging 1.00
R9362:Myom1 UTSW 17 71,343,288 (GRCm39) missense probably benign 0.00
R9440:Myom1 UTSW 17 71,433,329 (GRCm39) missense probably benign 0.00
R9469:Myom1 UTSW 17 71,368,122 (GRCm39) missense possibly damaging 0.79
R9568:Myom1 UTSW 17 71,394,476 (GRCm39) missense probably damaging 1.00
R9612:Myom1 UTSW 17 71,412,475 (GRCm39) nonsense probably null
R9645:Myom1 UTSW 17 71,399,204 (GRCm39) missense probably benign 0.01
X0019:Myom1 UTSW 17 71,407,066 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AATGCCATCCTGAGGGTCAG -3'
(R):5'- GATGGAATCTTACCAGGAGCC -3'

Sequencing Primer
(F):5'- GTCAGCTCAGAGACCCTAAGG -3'
(R):5'- GCCTAAAATATGAAACTGGGTCTGAC -3'
Posted On 2019-06-26