Mutagenetix > Incidental Mutations

Incidental Mutation 'R7169:Cdh20'

558093

Institutional Source

Beutler Lab

Gene Symbol

Cdh20

Ensembl Gene

ENSMUSG00000050840

Gene Name

cadherin 20

Synonyms

Cdh7

MMRRC Submission

Accession Numbers

Genbank: NM_011800

Is this an essential gene?

Possibly non essential (E-score: 0.254) question?

Stock #

R7169 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

104768529-104995481 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 104947353 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 287 (A287T)

Ref Sequence

ENSEMBL: ENSMUSP00000052078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062528]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000062528
AA Change: A287T

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000052078
Gene: ENSMUSG00000050840
AA Change: A287T

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
CA	82	163	1.01e-15	SMART
CA	187	272	1.35e-30	SMART
CA	296	388	1.98e-14	SMART
CA	411	492	1.61e-23	SMART
CA	515	602	3.9e-13	SMART
transmembrane domain	620	642	N/A	INTRINSIC
Pfam:Cadherin_C	645	793	2.6e-49	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type II classical cadherin from the cadherin superfamily and one of three cadherin 7-like genes located in a cluster on chromosome 18. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Since disturbance of intracellular adhesion is a prerequisite for invasion and metastasis of tumor cells, cadherins are considered prime candidates for tumor suppressor genes. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts14	A	G	10: 61,204,928	V870A	probably damaging	Het
Ahi1	T	G	10: 21,055,019	D919E	probably damaging	Het
Angptl6	T	A	9: 20,875,179	R390S	probably damaging	Het
Arhgef11	A	G	3: 87,727,448	I873V	possibly damaging	Het
BC024063	T	C	10: 82,110,459	Y638H	possibly damaging	Het
Brsk1	T	C	7: 4,715,404	S751P	probably benign	Het
Clic3	G	A	2: 25,458,719	R237H	probably benign	Het
Cog6	G	T	3: 52,989,966	P562H	possibly damaging	Het
Csnk2a2	A	G	8: 95,488,378	Y24H		Het
Ctif	T	C	18: 75,472,016	D484G	probably damaging	Het
Dennd6b	A	T	15: 89,188,852	F161I	possibly damaging	Het
Dnah14	G	T	1: 181,702,365	V2235L	probably benign	Het
Dnah6	A	T	6: 73,038,746	V3636D	probably damaging	Het
Dpm1	A	T	2: 168,211,423	Y207*	probably null	Het
Eml3	A	G	19: 8,933,464	T227A	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Eppk1	C	A	15: 76,105,914	A2256S	probably benign	Het
Etnppl	A	T	3: 130,620,696	N80I	probably damaging	Het
Eya4	A	T	10: 23,155,947	N236K	probably benign	Het
Fam26e	T	A	10: 34,092,164	T298S	probably damaging	Het
Fam49a	A	G	12: 12,359,232	D71G	possibly damaging	Het
Fam84a	A	G	12: 14,150,618	F36S	probably damaging	Het
Gm12886	T	G	4: 121,416,751	Q89H	probably damaging	Het
Gsdme	T	C	6: 50,227,378	T200A	probably benign	Het
Hipk1	C	T	3: 103,744,217	A1122T	probably benign	Het
Icos	A	G	1: 60,995,546	D176G	probably damaging	Het
Igkv5-43	T	A	6: 69,823,535	Y56F	probably damaging	Het
Il1r1	T	C	1: 40,293,359		probably null	Het
Ildr2	G	A	1: 166,307,934		probably null	Het
Ilf3	T	A	9: 21,395,426	H305Q	probably damaging	Het
Insrr	A	G	3: 87,808,594	H532R	probably benign	Het
Lmbr1l	CACTACATACTACATACTACATACTACATACTACATACTACATAC	CACTACATACTACATACTACATACTACATACTACATACTACATACTACATAC	15: 98,909,158		probably null	Het
Lmbr1l	ACTACAT	ACTACATGCTACAT	15: 98,909,194		probably benign	Het
Lrrc25	T	G	8: 70,617,787	S73A	probably benign	Het
Lrrn1	T	C	6: 107,567,604	L121P	probably damaging	Het
Ly6c1	C	A	15: 75,044,646	V116L	probably benign	Het
Meltf	A	G	16: 31,880,162	D30G	probably benign	Het
Mroh7	T	A	4: 106,691,639	D1009V	probably damaging	Het
Mybpc3	T	C	2: 91,118,179	V4A	possibly damaging	Het
Mycbp2	A	G	14: 103,260,200	S979P	possibly damaging	Het
Ntn5	C	T	7: 45,686,774	R210*	probably null	Het
Nuak1	T	C	10: 84,374,745	D493G	probably damaging	Het
Olfr1281	T	A	2: 111,328,598	Y60N	probably damaging	Het
Olfr1306	A	G	2: 111,912,594	M112T	possibly damaging	Het
Olfr211	G	T	6: 116,494,064	A152S	probably benign	Het
Olfr680-ps1	T	C	7: 105,091,190	I150V	possibly damaging	Het
Oprk1	T	A	1: 5,589,081	D11E	probably benign	Het
Pkd1l2	T	A	8: 117,040,835	T1239S	possibly damaging	Het
Pkm	A	G	9: 59,671,625	D296G	possibly damaging	Het
Pof1b	A	G	X: 112,644,345	I544T	probably benign	Het
Pop5	T	A	5: 115,240,228	V77E	possibly damaging	Het
Ppp1r10	T	C	17: 35,929,473	S552P	probably damaging	Het
Rabggta	C	G	14: 55,720,901	R101P	probably damaging	Het
Rorc	A	T	3: 94,389,180	E243V	probably benign	Het
Setmar	C	A	6: 108,065,088	A3E	possibly damaging	Het
Skor2	T	A	18: 76,860,986	V801E	probably benign	Het
Slc12a7	G	A	13: 73,784,560	V56M	probably benign	Het
Snph	T	A	2: 151,594,387	N207I	probably damaging	Het
Snx14	A	G	9: 88,398,309	V531A	probably damaging	Het
Thap1	CAGCATCTGCTCGGAGCA	CAGCA	8: 26,160,856		probably null	Het
Tlr3	A	T	8: 45,397,019	M871K	probably damaging	Het
Tnfrsf11a	A	T	1: 105,844,695	R569S	possibly damaging	Het
Trim66	A	G	7: 109,455,121	V1294A	probably benign	Het
Vldlr	G	A	19: 27,244,328	V698I	probably benign	Het
Vmn2r73	G	A	7: 85,858,455	Q550*	probably null	Het
Zdhhc5	A	T	2: 84,702,331		probably null	Het
Zfhx3	T	A	8: 108,951,398	Y3027N	possibly damaging	Het
Zfp663	C	T	2: 165,352,439	S620N	probably benign	Het

Other mutations in Cdh20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Cdh20	APN	1	104953887	missense	probably benign	0.05
IGL00743:Cdh20	APN	1	104947428	missense	probably benign	0.06
IGL00848:Cdh20	APN	1	104934256	missense	probably benign
IGL01393:Cdh20	APN	1	104934244	missense	probably benign
IGL01396:Cdh20	APN	1	104947429	missense	possibly damaging	0.59
IGL01485:Cdh20	APN	1	104934107	missense	probably benign	0.05
IGL01612:Cdh20	APN	1	104994170	missense	probably benign	0.02
IGL01947:Cdh20	APN	1	104993924	missense	possibly damaging	0.91
IGL01967:Cdh20	APN	1	104941037	missense	probably damaging	1.00
IGL02226:Cdh20	APN	1	104954091	splice site	probably benign
IGL02318:Cdh20	APN	1	104954039	missense	probably null	0.03
IGL02326:Cdh20	APN	1	104975039	missense	probably damaging	0.97
IGL02798:Cdh20	APN	1	104947465	missense	probably damaging	0.97
IGL02963:Cdh20	APN	1	104934098	start codon destroyed	probably null	0.66
IGL03081:Cdh20	APN	1	104941257	missense	probably damaging	1.00
3-1:Cdh20	UTSW	1	104947420	missense	possibly damaging	0.84
IGL02991:Cdh20	UTSW	1	104934247	missense	probably benign
R0178:Cdh20	UTSW	1	104975051	missense	possibly damaging	0.82
R1114:Cdh20	UTSW	1	104979014	missense	probably damaging	0.96
R1401:Cdh20	UTSW	1	104947497	missense	possibly damaging	0.65
R1502:Cdh20	UTSW	1	104954030	missense	probably benign	0.06
R1764:Cdh20	UTSW	1	104934345	splice site	probably benign
R2198:Cdh20	UTSW	1	104947322	critical splice acceptor site	probably null
R2279:Cdh20	UTSW	1	104947414	missense	probably damaging	1.00
R2419:Cdh20	UTSW	1	104975015	missense	possibly damaging	0.92
R2897:Cdh20	UTSW	1	104947474	missense	probably damaging	1.00
R4243:Cdh20	UTSW	1	104942143	missense	probably damaging	1.00
R4244:Cdh20	UTSW	1	104942143	missense	probably damaging	1.00
R4349:Cdh20	UTSW	1	104979089	missense	probably damaging	1.00
R4350:Cdh20	UTSW	1	104979089	missense	probably damaging	1.00
R4352:Cdh20	UTSW	1	104979089	missense	probably damaging	1.00
R4353:Cdh20	UTSW	1	104979089	missense	probably damaging	1.00
R4719:Cdh20	UTSW	1	104934310	missense	probably damaging	0.97
R4754:Cdh20	UTSW	1	104984685	missense	probably damaging	0.99
R4795:Cdh20	UTSW	1	104941264	missense	probably damaging	1.00
R4796:Cdh20	UTSW	1	104941264	missense	probably damaging	1.00
R4955:Cdh20	UTSW	1	104984803	missense	probably damaging	1.00
R5056:Cdh20	UTSW	1	104953997	missense	probably benign	0.00
R5127:Cdh20	UTSW	1	104947348	missense	probably damaging	1.00
R5269:Cdh20	UTSW	1	104934157	missense	possibly damaging	0.67
R5563:Cdh20	UTSW	1	104947357	missense	probably benign	0.29
R5634:Cdh20	UTSW	1	104975075	missense	probably damaging	0.97
R5708:Cdh20	UTSW	1	104984910	missense	probably damaging	1.00
R5822:Cdh20	UTSW	1	104934098	start codon destroyed	probably null	0.49
R5933:Cdh20	UTSW	1	104984671	missense	probably damaging	1.00
R6109:Cdh20	UTSW	1	104994014	missense	probably damaging	1.00
R6521:Cdh20	UTSW	1	104942134	missense	probably damaging	1.00
R6911:Cdh20	UTSW	1	104984686	missense	possibly damaging	0.95
R7207:Cdh20	UTSW	1	104993977	missense	probably damaging	0.98
R7208:Cdh20	UTSW	1	104954071	missense	possibly damaging	0.63
R7297:Cdh20	UTSW	1	104970873	missense	probably benign
R7535:Cdh20	UTSW	1	104975043	missense	probably damaging	1.00
R7587:Cdh20	UTSW	1	104941279	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAAGGTGCTTCTCACTACTCTG -3'
(R):5'- GAAACTGGATTACCTTCTTCACAG -3'

Sequencing Primer
(F):5'- GACACTCTGGACTGAAAATGTAAAC -3'
(R):5'- CACAGTTATGATGCCAACTTGG -3'

Posted On

2019-06-26