Incidental Mutation 'R7169:Cdh20'
ID558093
Institutional Source Beutler Lab
Gene Symbol Cdh20
Ensembl Gene ENSMUSG00000050840
Gene Namecadherin 20
SynonymsCdh7
MMRRC Submission
Accession Numbers

Genbank: NM_011800

Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R7169 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location104768529-104995481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104947353 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 287 (A287T)
Ref Sequence ENSEMBL: ENSMUSP00000052078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062528]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062528
AA Change: A287T

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052078
Gene: ENSMUSG00000050840
AA Change: A287T

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
CA 82 163 1.01e-15 SMART
CA 187 272 1.35e-30 SMART
CA 296 388 1.98e-14 SMART
CA 411 492 1.61e-23 SMART
CA 515 602 3.9e-13 SMART
transmembrane domain 620 642 N/A INTRINSIC
Pfam:Cadherin_C 645 793 2.6e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type II classical cadherin from the cadherin superfamily and one of three cadherin 7-like genes located in a cluster on chromosome 18. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Since disturbance of intracellular adhesion is a prerequisite for invasion and metastasis of tumor cells, cadherins are considered prime candidates for tumor suppressor genes. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 A G 10: 61,204,928 V870A probably damaging Het
Ahi1 T G 10: 21,055,019 D919E probably damaging Het
Angptl6 T A 9: 20,875,179 R390S probably damaging Het
Arhgef11 A G 3: 87,727,448 I873V possibly damaging Het
BC024063 T C 10: 82,110,459 Y638H possibly damaging Het
Brsk1 T C 7: 4,715,404 S751P probably benign Het
Clic3 G A 2: 25,458,719 R237H probably benign Het
Cog6 G T 3: 52,989,966 P562H possibly damaging Het
Csnk2a2 A G 8: 95,488,378 Y24H Het
Ctif T C 18: 75,472,016 D484G probably damaging Het
Dennd6b A T 15: 89,188,852 F161I possibly damaging Het
Dnah14 G T 1: 181,702,365 V2235L probably benign Het
Dnah6 A T 6: 73,038,746 V3636D probably damaging Het
Dpm1 A T 2: 168,211,423 Y207* probably null Het
Eml3 A G 19: 8,933,464 T227A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eppk1 C A 15: 76,105,914 A2256S probably benign Het
Etnppl A T 3: 130,620,696 N80I probably damaging Het
Eya4 A T 10: 23,155,947 N236K probably benign Het
Fam26e T A 10: 34,092,164 T298S probably damaging Het
Fam49a A G 12: 12,359,232 D71G possibly damaging Het
Fam84a A G 12: 14,150,618 F36S probably damaging Het
Gm12886 T G 4: 121,416,751 Q89H probably damaging Het
Gsdme T C 6: 50,227,378 T200A probably benign Het
Hipk1 C T 3: 103,744,217 A1122T probably benign Het
Icos A G 1: 60,995,546 D176G probably damaging Het
Igkv5-43 T A 6: 69,823,535 Y56F probably damaging Het
Il1r1 T C 1: 40,293,359 probably null Het
Ildr2 G A 1: 166,307,934 probably null Het
Ilf3 T A 9: 21,395,426 H305Q probably damaging Het
Insrr A G 3: 87,808,594 H532R probably benign Het
Lmbr1l CACTACATACTACATACTACATACTACATACTACATACTACATAC CACTACATACTACATACTACATACTACATACTACATACTACATACTACATAC 15: 98,909,158 probably null Het
Lmbr1l ACTACAT ACTACATGCTACAT 15: 98,909,194 probably benign Het
Lrrc25 T G 8: 70,617,787 S73A probably benign Het
Lrrn1 T C 6: 107,567,604 L121P probably damaging Het
Ly6c1 C A 15: 75,044,646 V116L probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Mroh7 T A 4: 106,691,639 D1009V probably damaging Het
Mybpc3 T C 2: 91,118,179 V4A possibly damaging Het
Mycbp2 A G 14: 103,260,200 S979P possibly damaging Het
Ntn5 C T 7: 45,686,774 R210* probably null Het
Nuak1 T C 10: 84,374,745 D493G probably damaging Het
Olfr1281 T A 2: 111,328,598 Y60N probably damaging Het
Olfr1306 A G 2: 111,912,594 M112T possibly damaging Het
Olfr211 G T 6: 116,494,064 A152S probably benign Het
Olfr680-ps1 T C 7: 105,091,190 I150V possibly damaging Het
Oprk1 T A 1: 5,589,081 D11E probably benign Het
Pkd1l2 T A 8: 117,040,835 T1239S possibly damaging Het
Pkm A G 9: 59,671,625 D296G possibly damaging Het
Pof1b A G X: 112,644,345 I544T probably benign Het
Pop5 T A 5: 115,240,228 V77E possibly damaging Het
Ppp1r10 T C 17: 35,929,473 S552P probably damaging Het
Rabggta C G 14: 55,720,901 R101P probably damaging Het
Rorc A T 3: 94,389,180 E243V probably benign Het
Setmar C A 6: 108,065,088 A3E possibly damaging Het
Skor2 T A 18: 76,860,986 V801E probably benign Het
Slc12a7 G A 13: 73,784,560 V56M probably benign Het
Snph T A 2: 151,594,387 N207I probably damaging Het
Snx14 A G 9: 88,398,309 V531A probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tlr3 A T 8: 45,397,019 M871K probably damaging Het
Tnfrsf11a A T 1: 105,844,695 R569S possibly damaging Het
Trim66 A G 7: 109,455,121 V1294A probably benign Het
Vldlr G A 19: 27,244,328 V698I probably benign Het
Vmn2r73 G A 7: 85,858,455 Q550* probably null Het
Zdhhc5 A T 2: 84,702,331 probably null Het
Zfhx3 T A 8: 108,951,398 Y3027N possibly damaging Het
Zfp663 C T 2: 165,352,439 S620N probably benign Het
Other mutations in Cdh20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Cdh20 APN 1 104953887 missense probably benign 0.05
IGL00743:Cdh20 APN 1 104947428 missense probably benign 0.06
IGL00848:Cdh20 APN 1 104934256 missense probably benign
IGL01393:Cdh20 APN 1 104934244 missense probably benign
IGL01396:Cdh20 APN 1 104947429 missense possibly damaging 0.59
IGL01485:Cdh20 APN 1 104934107 missense probably benign 0.05
IGL01612:Cdh20 APN 1 104994170 missense probably benign 0.02
IGL01947:Cdh20 APN 1 104993924 missense possibly damaging 0.91
IGL01967:Cdh20 APN 1 104941037 missense probably damaging 1.00
IGL02226:Cdh20 APN 1 104954091 splice site probably benign
IGL02318:Cdh20 APN 1 104954039 missense probably null 0.03
IGL02326:Cdh20 APN 1 104975039 missense probably damaging 0.97
IGL02798:Cdh20 APN 1 104947465 missense probably damaging 0.97
IGL02963:Cdh20 APN 1 104934098 start codon destroyed probably null 0.66
IGL03081:Cdh20 APN 1 104941257 missense probably damaging 1.00
3-1:Cdh20 UTSW 1 104947420 missense possibly damaging 0.84
IGL02991:Cdh20 UTSW 1 104934247 missense probably benign
R0178:Cdh20 UTSW 1 104975051 missense possibly damaging 0.82
R1114:Cdh20 UTSW 1 104979014 missense probably damaging 0.96
R1401:Cdh20 UTSW 1 104947497 missense possibly damaging 0.65
R1502:Cdh20 UTSW 1 104954030 missense probably benign 0.06
R1764:Cdh20 UTSW 1 104934345 splice site probably benign
R2198:Cdh20 UTSW 1 104947322 critical splice acceptor site probably null
R2279:Cdh20 UTSW 1 104947414 missense probably damaging 1.00
R2419:Cdh20 UTSW 1 104975015 missense possibly damaging 0.92
R2897:Cdh20 UTSW 1 104947474 missense probably damaging 1.00
R4243:Cdh20 UTSW 1 104942143 missense probably damaging 1.00
R4244:Cdh20 UTSW 1 104942143 missense probably damaging 1.00
R4349:Cdh20 UTSW 1 104979089 missense probably damaging 1.00
R4350:Cdh20 UTSW 1 104979089 missense probably damaging 1.00
R4352:Cdh20 UTSW 1 104979089 missense probably damaging 1.00
R4353:Cdh20 UTSW 1 104979089 missense probably damaging 1.00
R4719:Cdh20 UTSW 1 104934310 missense probably damaging 0.97
R4754:Cdh20 UTSW 1 104984685 missense probably damaging 0.99
R4795:Cdh20 UTSW 1 104941264 missense probably damaging 1.00
R4796:Cdh20 UTSW 1 104941264 missense probably damaging 1.00
R4955:Cdh20 UTSW 1 104984803 missense probably damaging 1.00
R5056:Cdh20 UTSW 1 104953997 missense probably benign 0.00
R5127:Cdh20 UTSW 1 104947348 missense probably damaging 1.00
R5269:Cdh20 UTSW 1 104934157 missense possibly damaging 0.67
R5563:Cdh20 UTSW 1 104947357 missense probably benign 0.29
R5634:Cdh20 UTSW 1 104975075 missense probably damaging 0.97
R5708:Cdh20 UTSW 1 104984910 missense probably damaging 1.00
R5822:Cdh20 UTSW 1 104934098 start codon destroyed probably null 0.49
R5933:Cdh20 UTSW 1 104984671 missense probably damaging 1.00
R6109:Cdh20 UTSW 1 104994014 missense probably damaging 1.00
R6521:Cdh20 UTSW 1 104942134 missense probably damaging 1.00
R6911:Cdh20 UTSW 1 104984686 missense possibly damaging 0.95
R7207:Cdh20 UTSW 1 104993977 missense probably damaging 0.98
R7208:Cdh20 UTSW 1 104954071 missense possibly damaging 0.63
R7297:Cdh20 UTSW 1 104970873 missense probably benign
R7535:Cdh20 UTSW 1 104975043 missense probably damaging 1.00
R7587:Cdh20 UTSW 1 104941279 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGGTGCTTCTCACTACTCTG -3'
(R):5'- GAAACTGGATTACCTTCTTCACAG -3'

Sequencing Primer
(F):5'- GACACTCTGGACTGAAAATGTAAAC -3'
(R):5'- CACAGTTATGATGCCAACTTGG -3'
Posted On2019-06-26