Mutagenetix > Incidental Mutation

Incidental Mutation 'R7169:Tnfrsf11a'

558094

Institutional Source

Beutler Lab

Gene Symbol

Tnfrsf11a

Ensembl Gene

ENSMUSG00000026321

Gene Name

tumor necrosis factor receptor superfamily, member 11a, NFKB activator

Synonyms

TRANCE-R, Rank

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.153) question?

Stock #

R7169 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

105780718-105847981 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 105844695 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 569 (R569S)

Ref Sequence

ENSEMBL: ENSMUSP00000027559 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027559]

AlphaFold

O35305

PDB Structure

Crystal structure of mouse RANKL-RANK complex [X-RAY DIFFRACTION]
Crystal structure of mouse RANK [X-RAY DIFFRACTION]
Crystal structure of extracellular domains of mouse RANK-RANKL complex [X-RAY DIFFRACTION]
Crystal Structure of mouse RANK bound to RANKL [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027559
AA Change: R569S

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000027559
Gene: ENSMUSG00000026321
AA Change: R569S

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
TNFR	35	69	1.48e-7	SMART
TNFR	72	113	2.59e-3	SMART
TNFR	115	152	4.28e-4	SMART
TNFR	155	195	5.27e-4	SMART
transmembrane domain	212	234	N/A	INTRINSIC
low complexity region	300	313	N/A	INTRINSIC
low complexity region	495	511	N/A	INTRINSIC
low complexity region	543	558	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptors can interact with various TRAF family proteins, through which this receptor induces the activation of NF-kappa B and MAPK8/JNK. This receptor and its ligand are important regulators of the interaction between T cells and dendritic cells. This receptor is also an essential mediator for osteoclast and lymph node development. Mutations at this locus have been associated with familial expansile osteolysis, autosomal recessive osteopetrosis, and Paget disease of bone. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out or spontaneous allele exhibit a failure of tooth eruption, osteopetrosis, and abnormal immune system morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts14	A	G	10: 61,204,928	V870A	probably damaging	Het
Ahi1	T	G	10: 21,055,019	D919E	probably damaging	Het
Angptl6	T	A	9: 20,875,179	R390S	probably damaging	Het
Arhgef11	A	G	3: 87,727,448	I873V	possibly damaging	Het
BC024063	T	C	10: 82,110,459	Y638H	possibly damaging	Het
Brsk1	T	C	7: 4,715,404	S751P	probably benign	Het
Cdh20	G	A	1: 104,947,353	A287T	possibly damaging	Het
Clic3	G	A	2: 25,458,719	R237H	probably benign	Het
Cog6	G	T	3: 52,989,966	P562H	possibly damaging	Het
Csnk2a2	A	G	8: 95,488,378	Y24H		Het
Ctif	T	C	18: 75,472,016	D484G	probably damaging	Het
Dennd6b	A	T	15: 89,188,852	F161I	possibly damaging	Het
Dnah14	G	T	1: 181,702,365	V2235L	probably benign	Het
Dnah6	A	T	6: 73,038,746	V3636D	probably damaging	Het
Dpm1	A	T	2: 168,211,423	Y207*	probably null	Het
Eml3	A	G	19: 8,933,464	T227A	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Eppk1	C	A	15: 76,105,914	A2256S	probably benign	Het
Etnppl	A	T	3: 130,620,696	N80I	probably damaging	Het
Eya4	A	T	10: 23,155,947	N236K	probably benign	Het
Fam26e	T	A	10: 34,092,164	T298S	probably damaging	Het
Fam49a	A	G	12: 12,359,232	D71G	possibly damaging	Het
Fam84a	A	G	12: 14,150,618	F36S	probably damaging	Het
Gm12886	T	G	4: 121,416,751	Q89H	probably damaging	Het
Gsdme	T	C	6: 50,227,378	T200A	probably benign	Het
Hipk1	C	T	3: 103,744,217	A1122T	probably benign	Het
Icos	A	G	1: 60,995,546	D176G	probably damaging	Het
Igkv5-43	T	A	6: 69,823,535	Y56F	probably damaging	Het
Il1r1	T	C	1: 40,293,359		probably null	Het
Ildr2	G	A	1: 166,307,934		probably null	Het
Ilf3	T	A	9: 21,395,426	H305Q	probably damaging	Het
Insrr	A	G	3: 87,808,594	H532R	probably benign	Het
Lmbr1l	CACTACATACTACATACTACATACTACATACTACATACTACATAC	CACTACATACTACATACTACATACTACATACTACATACTACATACTACATAC	15: 98,909,158		probably null	Het
Lmbr1l	ACTACAT	ACTACATGCTACAT	15: 98,909,194		probably benign	Het
Lrrc25	T	G	8: 70,617,787	S73A	probably benign	Het
Lrrn1	T	C	6: 107,567,604	L121P	probably damaging	Het
Ly6c1	C	A	15: 75,044,646	V116L	probably benign	Het
Meltf	A	G	16: 31,880,162	D30G	probably benign	Het
Mroh7	T	A	4: 106,691,639	D1009V	probably damaging	Het
Mybpc3	T	C	2: 91,118,179	V4A	possibly damaging	Het
Mycbp2	A	G	14: 103,260,200	S979P	possibly damaging	Het
Ntn5	C	T	7: 45,686,774	R210*	probably null	Het
Nuak1	T	C	10: 84,374,745	D493G	probably damaging	Het
Olfr1281	T	A	2: 111,328,598	Y60N	probably damaging	Het
Olfr1306	A	G	2: 111,912,594	M112T	possibly damaging	Het
Olfr211	G	T	6: 116,494,064	A152S	probably benign	Het
Olfr680-ps1	T	C	7: 105,091,190	I150V	possibly damaging	Het
Oprk1	T	A	1: 5,589,081	D11E	probably benign	Het
Pkd1l2	T	A	8: 117,040,835	T1239S	possibly damaging	Het
Pkm	A	G	9: 59,671,625	D296G	possibly damaging	Het
Pof1b	A	G	X: 112,644,345	I544T	probably benign	Het
Pop5	T	A	5: 115,240,228	V77E	possibly damaging	Het
Ppp1r10	T	C	17: 35,929,473	S552P	probably damaging	Het
Rabggta	C	G	14: 55,720,901	R101P	probably damaging	Het
Rorc	A	T	3: 94,389,180	E243V	probably benign	Het
Setmar	C	A	6: 108,065,088	A3E	possibly damaging	Het
Skor2	T	A	18: 76,860,986	V801E	probably benign	Het
Slc12a7	G	A	13: 73,784,560	V56M	probably benign	Het
Snph	T	A	2: 151,594,387	N207I	probably damaging	Het
Snx14	A	G	9: 88,398,309	V531A	probably damaging	Het
Thap1	CAGCATCTGCTCGGAGCA	CAGCA	8: 26,160,856		probably null	Het
Tlr3	A	T	8: 45,397,019	M871K	probably damaging	Het
Trim66	A	G	7: 109,455,121	V1294A	probably benign	Het
Vldlr	G	A	19: 27,244,328	V698I	probably benign	Het
Vmn2r73	G	A	7: 85,858,455	Q550*	probably null	Het
Zdhhc5	A	T	2: 84,702,331		probably null	Het
Zfhx3	T	A	8: 108,951,398	Y3027N	possibly damaging	Het
Zfp663	C	T	2: 165,352,439	S620N	probably benign	Het

Other mutations in Tnfrsf11a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01137:Tnfrsf11a	APN	1	105809422	missense	possibly damaging	0.80
IGL02429:Tnfrsf11a	APN	1	105827718	missense	probably benign	0.14
IGL03222:Tnfrsf11a	APN	1	105821490	missense	probably damaging	1.00
IGL03276:Tnfrsf11a	APN	1	105821490	missense	probably damaging	1.00
PIT4354001:Tnfrsf11a	UTSW	1	105821517	missense	probably damaging	1.00
R0321:Tnfrsf11a	UTSW	1	105844857	nonsense	probably null
R0514:Tnfrsf11a	UTSW	1	105826992	missense	probably damaging	1.00
R0655:Tnfrsf11a	UTSW	1	105808155	missense	unknown
R1470:Tnfrsf11a	UTSW	1	105825048	missense	probably damaging	0.96
R1470:Tnfrsf11a	UTSW	1	105825048	missense	probably damaging	0.96
R1868:Tnfrsf11a	UTSW	1	105844705	missense	probably damaging	1.00
R2900:Tnfrsf11a	UTSW	1	105827061	missense	probably benign	0.03
R3418:Tnfrsf11a	UTSW	1	105809405	missense	possibly damaging	0.84
R3816:Tnfrsf11a	UTSW	1	105809360	missense	probably damaging	0.96
R3817:Tnfrsf11a	UTSW	1	105809360	missense	probably damaging	0.96
R3818:Tnfrsf11a	UTSW	1	105809360	missense	probably damaging	0.96
R3819:Tnfrsf11a	UTSW	1	105809360	missense	probably damaging	0.96
R3879:Tnfrsf11a	UTSW	1	105809360	missense	probably damaging	0.96
R4037:Tnfrsf11a	UTSW	1	105827739	splice site	probably null
R4039:Tnfrsf11a	UTSW	1	105827739	splice site	probably null
R4238:Tnfrsf11a	UTSW	1	105827237	missense	probably damaging	1.00
R5708:Tnfrsf11a	UTSW	1	105813820	splice site	probably null
R6102:Tnfrsf11a	UTSW	1	105819946	missense	possibly damaging	0.62
R6910:Tnfrsf11a	UTSW	1	105844546	missense	probably damaging	1.00
R7178:Tnfrsf11a	UTSW	1	105827539	missense	probably benign	0.04
R7293:Tnfrsf11a	UTSW	1	105808141	critical splice acceptor site	probably null
R7323:Tnfrsf11a	UTSW	1	105844730	missense	probably damaging	1.00
R7334:Tnfrsf11a	UTSW	1	105827129	missense	possibly damaging	0.92
R7607:Tnfrsf11a	UTSW	1	105844732	missense	probably benign	0.02
R7614:Tnfrsf11a	UTSW	1	105827369	missense	probably damaging	1.00
R7651:Tnfrsf11a	UTSW	1	105809446	missense	probably damaging	1.00
R7908:Tnfrsf11a	UTSW	1	105809374	missense	probably damaging	1.00
R8078:Tnfrsf11a	UTSW	1	105817684	missense	probably damaging	1.00
R8364:Tnfrsf11a	UTSW	1	105817687	missense	probably damaging	0.99
R8859:Tnfrsf11a	UTSW	1	105844518	critical splice acceptor site	probably null
R8979:Tnfrsf11a	UTSW	1	105827100	missense	possibly damaging	0.78
R9008:Tnfrsf11a	UTSW	1	105827129	missense	possibly damaging	0.92
R9016:Tnfrsf11a	UTSW	1	105827129	missense	possibly damaging	0.92
R9017:Tnfrsf11a	UTSW	1	105827129	missense	possibly damaging	0.92
R9052:Tnfrsf11a	UTSW	1	105827129	missense	possibly damaging	0.92
Z1177:Tnfrsf11a	UTSW	1	105826999	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TGCTGTAGCTCTGATTGTAATCC -3'
(R):5'- ATTCTGCACATTGTCCGGAC -3'

Sequencing Primer
(F):5'- AATCCATAATGCAGTTTCTCTGTGC -3'
(R):5'- CCCCTGGGTATGGAGTGAAGTC -3'

Posted On

2019-06-26