Mutagenetix > Incidental Mutations

Incidental Mutation 'R7169:Dnah14'

558096

Institutional Source

Beutler Lab

Gene Symbol

Dnah14

Ensembl Gene

ENSMUSG00000047369

Gene Name

dynein, axonemal, heavy chain 14

Synonyms

Dnahc14, Gm980, LOC381311, A230079K17Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R7169 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

181576559-181815774 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 181702365 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 2235 (V2235L)

Ref Sequence

ENSEMBL: ENSMUSP00000146843 (fasta)

Predicted Effect

probably benign
Transcript: ENSMUST00000208001
AA Change: V2235L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts14	A	G	10: 61,204,928	V870A	probably damaging	Het
Ahi1	T	G	10: 21,055,019	D919E	probably damaging	Het
Angptl6	T	A	9: 20,875,179	R390S	probably damaging	Het
Arhgef11	A	G	3: 87,727,448	I873V	possibly damaging	Het
BC024063	T	C	10: 82,110,459	Y638H	possibly damaging	Het
Brsk1	T	C	7: 4,715,404	S751P	probably benign	Het
Cdh20	G	A	1: 104,947,353	A287T	possibly damaging	Het
Clic3	G	A	2: 25,458,719	R237H	probably benign	Het
Cog6	G	T	3: 52,989,966	P562H	possibly damaging	Het
Csnk2a2	A	G	8: 95,488,378	Y24H		Het
Ctif	T	C	18: 75,472,016	D484G	probably damaging	Het
Dennd6b	A	T	15: 89,188,852	F161I	possibly damaging	Het
Dnah6	A	T	6: 73,038,746	V3636D	probably damaging	Het
Dpm1	A	T	2: 168,211,423	Y207*	probably null	Het
Eml3	A	G	19: 8,933,464	T227A	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Eppk1	C	A	15: 76,105,914	A2256S	probably benign	Het
Etnppl	A	T	3: 130,620,696	N80I	probably damaging	Het
Eya4	A	T	10: 23,155,947	N236K	probably benign	Het
Fam26e	T	A	10: 34,092,164	T298S	probably damaging	Het
Fam49a	A	G	12: 12,359,232	D71G	possibly damaging	Het
Fam84a	A	G	12: 14,150,618	F36S	probably damaging	Het
Gm12886	T	G	4: 121,416,751	Q89H	probably damaging	Het
Gsdme	T	C	6: 50,227,378	T200A	probably benign	Het
Hipk1	C	T	3: 103,744,217	A1122T	probably benign	Het
Icos	A	G	1: 60,995,546	D176G	probably damaging	Het
Igkv5-43	T	A	6: 69,823,535	Y56F	probably damaging	Het
Il1r1	T	C	1: 40,293,359		probably null	Het
Ildr2	G	A	1: 166,307,934		probably null	Het
Ilf3	T	A	9: 21,395,426	H305Q	probably damaging	Het
Insrr	A	G	3: 87,808,594	H532R	probably benign	Het
Lmbr1l	CACTACATACTACATACTACATACTACATACTACATACTACATAC	CACTACATACTACATACTACATACTACATACTACATACTACATACTACATAC	15: 98,909,158		probably null	Het
Lmbr1l	ACTACAT	ACTACATGCTACAT	15: 98,909,194		probably benign	Het
Lrrc25	T	G	8: 70,617,787	S73A	probably benign	Het
Lrrn1	T	C	6: 107,567,604	L121P	probably damaging	Het
Ly6c1	C	A	15: 75,044,646	V116L	probably benign	Het
Meltf	A	G	16: 31,880,162	D30G	probably benign	Het
Mroh7	T	A	4: 106,691,639	D1009V	probably damaging	Het
Mybpc3	T	C	2: 91,118,179	V4A	possibly damaging	Het
Mycbp2	A	G	14: 103,260,200	S979P	possibly damaging	Het
Ntn5	C	T	7: 45,686,774	R210*	probably null	Het
Nuak1	T	C	10: 84,374,745	D493G	probably damaging	Het
Olfr1281	T	A	2: 111,328,598	Y60N	probably damaging	Het
Olfr1306	A	G	2: 111,912,594	M112T	possibly damaging	Het
Olfr211	G	T	6: 116,494,064	A152S	probably benign	Het
Olfr680-ps1	T	C	7: 105,091,190	I150V	possibly damaging	Het
Oprk1	T	A	1: 5,589,081	D11E	probably benign	Het
Pkd1l2	T	A	8: 117,040,835	T1239S	possibly damaging	Het
Pkm	A	G	9: 59,671,625	D296G	possibly damaging	Het
Pof1b	A	G	X: 112,644,345	I544T	probably benign	Het
Pop5	T	A	5: 115,240,228	V77E	possibly damaging	Het
Ppp1r10	T	C	17: 35,929,473	S552P	probably damaging	Het
Rabggta	C	G	14: 55,720,901	R101P	probably damaging	Het
Rorc	A	T	3: 94,389,180	E243V	probably benign	Het
Setmar	C	A	6: 108,065,088	A3E	possibly damaging	Het
Skor2	T	A	18: 76,860,986	V801E	probably benign	Het
Slc12a7	G	A	13: 73,784,560	V56M	probably benign	Het
Snph	T	A	2: 151,594,387	N207I	probably damaging	Het
Snx14	A	G	9: 88,398,309	V531A	probably damaging	Het
Thap1	CAGCATCTGCTCGGAGCA	CAGCA	8: 26,160,856		probably null	Het
Tlr3	A	T	8: 45,397,019	M871K	probably damaging	Het
Tnfrsf11a	A	T	1: 105,844,695	R569S	possibly damaging	Het
Trim66	A	G	7: 109,455,121	V1294A	probably benign	Het
Vldlr	G	A	19: 27,244,328	V698I	probably benign	Het
Vmn2r73	G	A	7: 85,858,455	Q550*	probably null	Het
Zdhhc5	A	T	2: 84,702,331		probably null	Het
Zfhx3	T	A	8: 108,951,398	Y3027N	possibly damaging	Het
Zfp663	C	T	2: 165,352,439	S620N	probably benign	Het

Other mutations in Dnah14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Dnah14	APN	1	181752046	missense	probably benign	0.17
IGL01764:Dnah14	APN	1	181744777	missense	probably benign	0.00
IGL03218:Dnah14	APN	1	181755269	missense	probably benign	0.02
IGL03290:Dnah14	APN	1	181763978	splice site	probably benign
IGL03384:Dnah14	APN	1	181745949	missense	probably benign	0.03
R0009:Dnah14	UTSW	1	181769407	splice site	probably benign
R0125:Dnah14	UTSW	1	181752063	missense	probably damaging	0.99
R0579:Dnah14	UTSW	1	181744747	missense	possibly damaging	0.72
R0973:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R0973:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R0974:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R1609:Dnah14	UTSW	1	181750177	missense	probably damaging	0.97
R1860:Dnah14	UTSW	1	181763960	missense	probably damaging	1.00
R2050:Dnah14	UTSW	1	181752562	missense	probably damaging	1.00
R2974:Dnah14	UTSW	1	181755241	critical splice acceptor site	probably null
R4715:Dnah14	UTSW	1	181757223	missense	probably damaging	1.00
R5076:Dnah14	UTSW	1	181757234	missense	probably benign	0.01
R5424:Dnah14	UTSW	1	181763310	missense	possibly damaging	0.95
R5808:Dnah14	UTSW	1	181741159	missense	possibly damaging	0.72
R5997:Dnah14	UTSW	1	181770105	missense	probably benign	0.00
R6052:Dnah14	UTSW	1	181666487	missense	possibly damaging	0.50
R6061:Dnah14	UTSW	1	181709051	missense	probably damaging	1.00
R6089:Dnah14	UTSW	1	181750154	missense	probably damaging	1.00
R6092:Dnah14	UTSW	1	181621833	missense	probably benign	0.13
R6145:Dnah14	UTSW	1	181666417	missense	probably benign	0.00
R6163:Dnah14	UTSW	1	181666361	missense	probably benign	0.33
R6246:Dnah14	UTSW	1	181680888	missense	probably benign	0.00
R6302:Dnah14	UTSW	1	181601206	missense	possibly damaging	0.96
R6306:Dnah14	UTSW	1	181585024	frame shift	probably null
R6326:Dnah14	UTSW	1	181783556	missense	probably damaging	1.00
R6348:Dnah14	UTSW	1	181626720	missense	possibly damaging	0.83
R6367:Dnah14	UTSW	1	181755386	splice site	probably null
R6376:Dnah14	UTSW	1	181605894	missense	possibly damaging	0.79
R6389:Dnah14	UTSW	1	181651202	critical splice donor site	probably null
R6433:Dnah14	UTSW	1	181651657	missense	probably damaging	0.99
R6454:Dnah14	UTSW	1	181783705	missense	probably damaging	1.00
R6476:Dnah14	UTSW	1	181744768	missense	probably benign	0.26
R6523:Dnah14	UTSW	1	181643621	missense	probably benign	0.00
R6529:Dnah14	UTSW	1	181666469	missense	probably damaging	0.98
R6538:Dnah14	UTSW	1	181584985	missense	unknown
R6546:Dnah14	UTSW	1	181738987	missense	probably damaging	1.00
R6752:Dnah14	UTSW	1	181593452	missense	probably benign	0.07
R6762:Dnah14	UTSW	1	181757259	missense	probably damaging	1.00
R6786:Dnah14	UTSW	1	181641405	missense	probably benign	0.21
R6849:Dnah14	UTSW	1	181808945	missense	probably benign	0.00
R6877:Dnah14	UTSW	1	181628432	missense	possibly damaging	0.82
R6912:Dnah14	UTSW	1	181750183	missense	possibly damaging	0.83
R6919:Dnah14	UTSW	1	181585066	missense	probably benign	0.04
R6924:Dnah14	UTSW	1	181627952	missense	probably benign	0.04
R6957:Dnah14	UTSW	1	181785175	missense	possibly damaging	0.92
R6980:Dnah14	UTSW	1	181648230	missense	probably benign	0.00
R7018:Dnah14	UTSW	1	181626944	missense	possibly damaging	0.55
R7046:Dnah14	UTSW	1	181623003	missense	probably benign	0.01
R7058:Dnah14	UTSW	1	181698049	missense	probably benign	0.00
R7068:Dnah14	UTSW	1	181769790	missense	probably benign	0.35
R7115:Dnah14	UTSW	1	181720145	missense	probably damaging	1.00
R7130:Dnah14	UTSW	1	181745958	nonsense	probably null
R7165:Dnah14	UTSW	1	181704535	missense	probably benign	0.00
R7184:Dnah14	UTSW	1	181704529	nonsense	probably null
R7232:Dnah14	UTSW	1	181757363	missense	probably damaging	1.00
R7260:Dnah14	UTSW	1	181706744	missense	probably damaging	0.99
R7276:Dnah14	UTSW	1	181685807	missense	probably benign	0.41
R7290:Dnah14	UTSW	1	181628174	missense	probably benign	0.20
R7314:Dnah14	UTSW	1	181785254	splice site	probably null
R7326:Dnah14	UTSW	1	181598403	missense	probably benign	0.02
R7336:Dnah14	UTSW	1	181797734	missense	probably damaging	0.96
R7363:Dnah14	UTSW	1	181690524	splice site	probably null
R7371:Dnah14	UTSW	1	181626885	missense	probably benign	0.05
R7376:Dnah14	UTSW	1	181763402	missense	probably benign	0.03
R7418:Dnah14	UTSW	1	181616742	missense	possibly damaging	0.92
R7473:Dnah14	UTSW	1	181752139	missense	probably damaging	0.99
R7514:Dnah14	UTSW	1	181628067	missense	probably damaging	0.96
R7555:Dnah14	UTSW	1	181770054	missense	probably benign	0.26
R7641:Dnah14	UTSW	1	181707533	missense	probably benign	0.01
R7663:Dnah14	UTSW	1	181752155	splice site	probably null
R7674:Dnah14	UTSW	1	181707533	missense	probably benign	0.01
R7680:Dnah14	UTSW	1	181685800	missense	probably benign	0.15
R7709:Dnah14	UTSW	1	181702484	critical splice donor site	probably null
R7842:Dnah14	UTSW	1	181627898	missense	probably damaging	0.99
R7861:Dnah14	UTSW	1	181616759	missense	probably damaging	1.00
R7988:Dnah14	UTSW	1	181783574	missense	probably damaging	0.97
R8016:Dnah14	UTSW	1	181648311	missense	probably benign	0.05
R8042:Dnah14	UTSW	1	181643631	critical splice donor site	probably null
R8071:Dnah14	UTSW	1	181615894	missense	possibly damaging	0.84
R8086:Dnah14	UTSW	1	181766232	missense	probably damaging	1.00
R8095:Dnah14	UTSW	1	181806032	nonsense	probably null
R8139:Dnah14	UTSW	1	181755288	missense	probably damaging	1.00
R8176:Dnah14	UTSW	1	181657033	missense	probably damaging	0.96
R8193:Dnah14	UTSW	1	181688205	missense	probably damaging	1.00
R8197:Dnah14	UTSW	1	181690101	missense	possibly damaging	0.94
R8209:Dnah14	UTSW	1	181795545	missense	possibly damaging	0.69
R8226:Dnah14	UTSW	1	181795545	missense	possibly damaging	0.69
R8251:Dnah14	UTSW	1	181664865	missense	probably damaging	1.00
R8264:Dnah14	UTSW	1	181744792	missense	probably damaging	0.99
R8284:Dnah14	UTSW	1	181773811	missense	probably benign	0.03
R8289:Dnah14	UTSW	1	181716215	nonsense	probably null
R8323:Dnah14	UTSW	1	181704544	missense	probably benign	0.01
R8442:Dnah14	UTSW	1	181741284	missense	probably damaging	0.97
R8458:Dnah14	UTSW	1	181806012	missense
R8507:Dnah14	UTSW	1	181641414	missense	probably benign	0.02
R8509:Dnah14	UTSW	1	181814655	missense
R8520:Dnah14	UTSW	1	181653638	missense	probably damaging	1.00
R8530:Dnah14	UTSW	1	181664946	missense	probably damaging	1.00
R8703:Dnah14	UTSW	1	181666011	nonsense	probably null
R8710:Dnah14	UTSW	1	181690311	missense	probably benign	0.04
R8752:Dnah14	UTSW	1	181628016	missense	probably benign	0.00
R8792:Dnah14	UTSW	1	181814624	missense
R8797:Dnah14	UTSW	1	181637847	missense	probably benign	0.19
R8821:Dnah14	UTSW	1	181792004	nonsense	probably null
R8834:Dnah14	UTSW	1	181616750	missense	possibly damaging	0.83
R8913:Dnah14	UTSW	1	181725498	missense	probably benign	0.01
R8925:Dnah14	UTSW	1	181680756	missense	probably damaging	1.00
R8927:Dnah14	UTSW	1	181680756	missense	probably damaging	1.00
R8934:Dnah14	UTSW	1	181622723	missense	possibly damaging	0.84
RF007:Dnah14	UTSW	1	181685809	missense	probably benign	0.00
RF012:Dnah14	UTSW	1	181627898	missense	probably damaging	0.99
Z1176:Dnah14	UTSW	1	181757351	missense	possibly damaging	0.83
Z1177:Dnah14	UTSW	1	181690320	missense	probably benign	0.03
Z1177:Dnah14	UTSW	1	181763334	missense	probably damaging	1.00
Z1177:Dnah14	UTSW	1	181766304	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCCAGAGACAGCCATCTC -3'
(R):5'- GCATTCATAGGCTGTTTGTAGGAC -3'

Sequencing Primer
(F):5'- GAGACAGCCATCTCTGACATC -3'
(R):5'- GGACTGTGAAAATTAGTCTCTCTG -3'

Posted On

2019-06-26