Incidental Mutation 'R0587:Large1'
ID 55810
Institutional Source Beutler Lab
Gene Symbol Large1
Ensembl Gene ENSMUSG00000004383
Gene Name LARGE xylosyl- and glucuronyltransferase 1
Synonyms froggy, BPFD#36, fg, enr
MMRRC Submission 038777-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock # R0587 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 72814599-73353540 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72859333 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 382 (N382D)
Ref Sequence ENSEMBL: ENSMUSP00000148336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004497] [ENSMUST00000119826] [ENSMUST00000212459]
AlphaFold Q9Z1M7
Predicted Effect probably damaging
Transcript: ENSMUST00000004497
AA Change: N382D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004497
Gene: ENSMUSG00000004383
AA Change: N382D

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
coiled coil region 55 90 N/A INTRINSIC
Pfam:Glyco_transf_8 141 387 6.2e-22 PFAM
Pfam:Glyco_transf_49 473 540 5.2e-15 PFAM
Pfam:Glyco_transf_49 535 743 1.1e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119826
AA Change: N382D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112617
Gene: ENSMUSG00000004383
AA Change: N382D

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
coiled coil region 55 90 N/A INTRINSIC
Pfam:Glyco_transf_8 142 386 3e-23 PFAM
Pfam:Glyco_transf_49 473 540 2.3e-11 PFAM
Pfam:Glyco_transf_49 520 743 2.7e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212459
AA Change: N382D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.9064 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 94% (34/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes exhibit a progressive myopathy, abnormal posture, thoracic kyphosis, calcium deposits in muscle, loss of Schwann cells and myelin, eye and CNS defects, deafness, reduced growth, and death around 4 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik T C 17: 35,892,963 *212W probably null Het
Abca1 A G 4: 53,107,035 Y231H probably benign Het
Abca5 T G 11: 110,311,377 I401L probably benign Het
Ak2 A G 4: 129,002,378 D112G probably damaging Het
Ankrd60 T A 2: 173,568,851 D292V possibly damaging Het
Bank1 A G 3: 136,214,037 probably benign Het
Bod1l G A 5: 41,821,637 S778L probably benign Het
Cep76 C A 18: 67,623,175 E529* probably null Het
Col24a1 T C 3: 145,293,145 V13A possibly damaging Het
Ctsc T A 7: 88,297,229 H154Q probably benign Het
Ctsf A G 19: 4,855,738 E87G probably benign Het
Dmxl1 A T 18: 49,935,307 T2716S probably benign Het
Espl1 A G 15: 102,303,947 probably benign Het
Fuk T A 8: 110,883,325 Q1019L probably damaging Het
Hnrnpul1 T A 7: 25,745,232 Y217F possibly damaging Het
Kmt2a A T 9: 44,847,534 M1039K probably damaging Het
Madd A G 2: 91,146,885 V1402A probably damaging Het
Mlh3 C T 12: 85,266,419 V998M probably benign Het
Myo1c A G 11: 75,657,790 Y71C probably damaging Het
Myt1l G A 12: 29,811,635 D139N unknown Het
Nes C A 3: 87,978,569 H1378Q probably benign Het
Olfr1259 T C 2: 89,943,392 H241R probably damaging Het
Otud6b T C 4: 14,815,661 E243G probably benign Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Pcm1 G T 8: 41,286,051 R912L probably damaging Het
Piezo2 A G 18: 63,022,426 I2449T possibly damaging Het
Slc12a5 G A 2: 164,976,533 M217I probably damaging Het
Sorl1 C A 9: 41,984,506 W1784C probably damaging Het
Spatc1l A G 10: 76,564,177 R178G possibly damaging Het
Strada A C 11: 106,170,964 Y154D probably damaging Het
Syt6 A G 3: 103,625,571 T424A probably damaging Het
Tbx1 C T 16: 18,583,493 A245T possibly damaging Het
Tmem143 T C 7: 45,907,054 L161P probably damaging Het
Other mutations in Large1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Large1 APN 8 72837497 missense probably damaging 1.00
IGL00326:Large1 APN 8 73131983 missense probably benign
IGL00418:Large1 APN 8 72823841 critical splice acceptor site probably null
IGL01155:Large1 APN 8 73131989 missense probably benign 0.01
IGL01793:Large1 APN 8 72859181 splice site probably benign
IGL01929:Large1 APN 8 72859275 missense probably damaging 1.00
IGL02218:Large1 APN 8 72912122 missense probably damaging 1.00
IGL02276:Large1 APN 8 72818093 missense probably benign 0.00
IGL02329:Large1 APN 8 73048317 missense possibly damaging 0.80
IGL02543:Large1 APN 8 73048414 missense probably benign 0.00
IGL02887:Large1 APN 8 73132039 missense probably benign 0.07
biggs UTSW 8 73116419 missense probably damaging 1.00
umber UTSW 8 72883264 nonsense probably null
R0179:Large1 UTSW 8 73098846 missense probably benign 0.09
R0477:Large1 UTSW 8 72818082 missense probably damaging 1.00
R0791:Large1 UTSW 8 73048479 splice site probably benign
R1253:Large1 UTSW 8 73048422 missense probably damaging 0.98
R1695:Large1 UTSW 8 72818082 missense probably damaging 1.00
R2017:Large1 UTSW 8 72852197 missense probably damaging 1.00
R4835:Large1 UTSW 8 73048347 missense probably damaging 1.00
R5105:Large1 UTSW 8 72852244 nonsense probably null
R5120:Large1 UTSW 8 72859341 missense probably damaging 1.00
R5135:Large1 UTSW 8 72818096 missense probably benign 0.38
R5137:Large1 UTSW 8 73048309 missense possibly damaging 0.58
R5567:Large1 UTSW 8 72837453 missense possibly damaging 0.93
R5945:Large1 UTSW 8 72852200 missense probably damaging 0.99
R6619:Large1 UTSW 8 72883264 nonsense probably null
R6951:Large1 UTSW 8 73116419 missense probably damaging 1.00
R7041:Large1 UTSW 8 73116464 missense probably damaging 0.98
R7300:Large1 UTSW 8 72837596 missense probably damaging 1.00
R7493:Large1 UTSW 8 72823715 missense probably benign 0.23
R7877:Large1 UTSW 8 73116443 missense probably damaging 1.00
R8118:Large1 UTSW 8 73131944 missense probably benign 0.40
R8129:Large1 UTSW 8 72815957 missense probably damaging 1.00
R8525:Large1 UTSW 8 72837492 missense probably damaging 1.00
R8963:Large1 UTSW 8 72815984 missense probably damaging 1.00
R9170:Large1 UTSW 8 72816017 missense probably benign 0.00
Z1088:Large1 UTSW 8 72912103 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCCCTGAGCTGGATGTAGTACCC -3'
(R):5'- CAGAGGCAAACTTGGTTCTATCCCC -3'

Sequencing Primer
(F):5'- CTGGATGTAGTACCCAACAAGGAC -3'
(R):5'- AAACTTGGTTCTATCCCCAGCAC -3'
Posted On 2013-07-11