Mutagenetix > Incidental Mutations

Incidental Mutation 'R0587:Large1'

55810

Institutional Source

Beutler Lab

Gene Symbol

Large1

Ensembl Gene

ENSMUSG00000004383

Gene Name

LARGE xylosyl- and glucuronyltransferase 1

Synonyms

froggy, BPFD#36, fg, enr

MMRRC Submission

038777-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.453) question?

Stock #

R0587 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72814599-73353540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 72859333 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 382 (N382D)

Ref Sequence

ENSEMBL: ENSMUSP00000148336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004497] [ENSMUST00000119826] [ENSMUST00000212459]

AlphaFold

Q9Z1M7

Predicted Effect

probably damaging
Transcript: ENSMUST00000004497
AA Change: N382D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000004497
Gene: ENSMUSG00000004383
AA Change: N382D

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
coiled coil region	55	90	N/A	INTRINSIC
Pfam:Glyco_transf_8	141	387	6.2e-22	PFAM
Pfam:Glyco_transf_49	473	540	5.2e-15	PFAM
Pfam:Glyco_transf_49	535	743	1.1e-47	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000119826
AA Change: N382D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112617
Gene: ENSMUSG00000004383
AA Change: N382D

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
coiled coil region	55	90	N/A	INTRINSIC
Pfam:Glyco_transf_8	142	386	3e-23	PFAM
Pfam:Glyco_transf_49	473	540	2.3e-11	PFAM
Pfam:Glyco_transf_49	520	743	2.7e-44	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000212459
AA Change: N382D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.9064

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.3%

Validation Efficiency

94% (34/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes exhibit a progressive myopathy, abnormal posture, thoracic kyphosis, calcium deposits in muscle, loss of Schwann cells and myelin, eye and CNS defects, deafness, reduced growth, and death around 4 months. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061I04Rik	T	C	17: 35,892,963	*212W	probably null	Het
Abca1	A	G	4: 53,107,035	Y231H	probably benign	Het
Abca5	T	G	11: 110,311,377	I401L	probably benign	Het
Ak2	A	G	4: 129,002,378	D112G	probably damaging	Het
Ankrd60	T	A	2: 173,568,851	D292V	possibly damaging	Het
Bank1	A	G	3: 136,214,037		probably benign	Het
Bod1l	G	A	5: 41,821,637	S778L	probably benign	Het
Cep76	C	A	18: 67,623,175	E529*	probably null	Het
Col24a1	T	C	3: 145,293,145	V13A	possibly damaging	Het
Ctsc	T	A	7: 88,297,229	H154Q	probably benign	Het
Ctsf	A	G	19: 4,855,738	E87G	probably benign	Het
Dmxl1	A	T	18: 49,935,307	T2716S	probably benign	Het
Espl1	A	G	15: 102,303,947		probably benign	Het
Fuk	T	A	8: 110,883,325	Q1019L	probably damaging	Het
Hnrnpul1	T	A	7: 25,745,232	Y217F	possibly damaging	Het
Kmt2a	A	T	9: 44,847,534	M1039K	probably damaging	Het
Madd	A	G	2: 91,146,885	V1402A	probably damaging	Het
Mlh3	C	T	12: 85,266,419	V998M	probably benign	Het
Myo1c	A	G	11: 75,657,790	Y71C	probably damaging	Het
Myt1l	G	A	12: 29,811,635	D139N	unknown	Het
Nes	C	A	3: 87,978,569	H1378Q	probably benign	Het
Olfr1259	T	C	2: 89,943,392	H241R	probably damaging	Het
Otud6b	T	C	4: 14,815,661	E243G	probably benign	Het
Pak3	TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	X: 143,743,893		probably benign	Het
Pcm1	G	T	8: 41,286,051	R912L	probably damaging	Het
Piezo2	A	G	18: 63,022,426	I2449T	possibly damaging	Het
Slc12a5	G	A	2: 164,976,533	M217I	probably damaging	Het
Sorl1	C	A	9: 41,984,506	W1784C	probably damaging	Het
Spatc1l	A	G	10: 76,564,177	R178G	possibly damaging	Het
Strada	A	C	11: 106,170,964	Y154D	probably damaging	Het
Syt6	A	G	3: 103,625,571	T424A	probably damaging	Het
Tbx1	C	T	16: 18,583,493	A245T	possibly damaging	Het
Tmem143	T	C	7: 45,907,054	L161P	probably damaging	Het

Other mutations in Large1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Large1	APN	8	72837497	missense	probably damaging	1.00
IGL00326:Large1	APN	8	73131983	missense	probably benign
IGL00418:Large1	APN	8	72823841	critical splice acceptor site	probably null
IGL01155:Large1	APN	8	73131989	missense	probably benign	0.01
IGL01793:Large1	APN	8	72859181	splice site	probably benign
IGL01929:Large1	APN	8	72859275	missense	probably damaging	1.00
IGL02218:Large1	APN	8	72912122	missense	probably damaging	1.00
IGL02276:Large1	APN	8	72818093	missense	probably benign	0.00
IGL02329:Large1	APN	8	73048317	missense	possibly damaging	0.80
IGL02543:Large1	APN	8	73048414	missense	probably benign	0.00
IGL02887:Large1	APN	8	73132039	missense	probably benign	0.07
biggs	UTSW	8	73116419	missense	probably damaging	1.00
umber	UTSW	8	72883264	nonsense	probably null
R0179:Large1	UTSW	8	73098846	missense	probably benign	0.09
R0477:Large1	UTSW	8	72818082	missense	probably damaging	1.00
R0791:Large1	UTSW	8	73048479	splice site	probably benign
R1253:Large1	UTSW	8	73048422	missense	probably damaging	0.98
R1695:Large1	UTSW	8	72818082	missense	probably damaging	1.00
R2017:Large1	UTSW	8	72852197	missense	probably damaging	1.00
R4835:Large1	UTSW	8	73048347	missense	probably damaging	1.00
R5105:Large1	UTSW	8	72852244	nonsense	probably null
R5120:Large1	UTSW	8	72859341	missense	probably damaging	1.00
R5135:Large1	UTSW	8	72818096	missense	probably benign	0.38
R5137:Large1	UTSW	8	73048309	missense	possibly damaging	0.58
R5567:Large1	UTSW	8	72837453	missense	possibly damaging	0.93
R5945:Large1	UTSW	8	72852200	missense	probably damaging	0.99
R6619:Large1	UTSW	8	72883264	nonsense	probably null
R6951:Large1	UTSW	8	73116419	missense	probably damaging	1.00
R7041:Large1	UTSW	8	73116464	missense	probably damaging	0.98
R7300:Large1	UTSW	8	72837596	missense	probably damaging	1.00
R7493:Large1	UTSW	8	72823715	missense	probably benign	0.23
R7877:Large1	UTSW	8	73116443	missense	probably damaging	1.00
R8118:Large1	UTSW	8	73131944	missense	probably benign	0.40
R8129:Large1	UTSW	8	72815957	missense	probably damaging	1.00
R8525:Large1	UTSW	8	72837492	missense	probably damaging	1.00
R8963:Large1	UTSW	8	72815984	missense	probably damaging	1.00
R9170:Large1	UTSW	8	72816017	missense	probably benign	0.00
Z1088:Large1	UTSW	8	72912103	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTCCCTGAGCTGGATGTAGTACCC -3'
(R):5'- CAGAGGCAAACTTGGTTCTATCCCC -3'

Sequencing Primer
(F):5'- CTGGATGTAGTACCCAACAAGGAC -3'
(R):5'- AAACTTGGTTCTATCCCCAGCAC -3'

Posted On

2013-07-11