Incidental Mutation 'R7170:Mstn'
ID558161
Institutional Source Beutler Lab
Gene Symbol Mstn
Ensembl Gene ENSMUSG00000026100
Gene Namemyostatin
SynonymsGdf8
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.377) question?
Stock #R7170 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location53061640-53068079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53066395 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 299 (I299F)
Ref Sequence ENSEMBL: ENSMUSP00000027269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027269] [ENSMUST00000191197]
PDB Structure
Crystal structure of the myostatin:follistatin 288 complex [X-RAY DIFFRACTION]
Crystal Structure of the Myostatin:Follistatin-like 3 Complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027269
AA Change: I299F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027269
Gene: ENSMUSG00000026100
AA Change: I299F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:TGFb_propeptide 38 266 1.3e-30 PFAM
TGFB 282 376 2.31e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191197
SMART Domains Protein: ENSMUSP00000140249
Gene: ENSMUSG00000026100

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 13 188 1.3e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein negatively regulates skeletal muscle cell proliferation and differentiation. Homozygous knockout mice for this gene exhibit increased muscle mass and bone density, and reduced adiposity. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit markedly increased size of striated muscle due to both hyperplasia and hypertrophy, reduced adiposity, and increased bone mineral density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik C A 9: 105,143,401 probably null Het
Abca8b T C 11: 109,945,828 T1214A probably benign Het
Adgrf5 G A 17: 43,446,138 V708M possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd7 T A 6: 18,868,390 Y170* probably null Het
Aplp2 T C 9: 31,170,443 D236G probably benign Het
Apoa5 T C 9: 46,270,139 M171T probably benign Het
Bcas3 T C 11: 85,495,918 V393A probably damaging Het
Ccdc47 T C 11: 106,202,478 N370S probably benign Het
Cfap77 A T 2: 28,985,842 Y85* probably null Het
Col4a3 G A 1: 82,715,909 probably null Het
Crnn T A 3: 93,148,713 S269T possibly damaging Het
Crocc2 G A 1: 93,193,982 A618T possibly damaging Het
D030056L22Rik A G 19: 18,713,373 K17R possibly damaging Het
Emx1 G A 6: 85,188,001 G20D probably benign Het
Fabp3 A G 4: 130,313,970 D88G probably benign Het
Fam124a A C 14: 62,587,180 D41A probably damaging Het
Fam198a G T 9: 121,978,235 A482S probably damaging Het
Fanca T C 8: 123,271,206 E1247G probably damaging Het
Fat3 T C 9: 16,006,574 R1518G probably damaging Het
Fgf12 T C 16: 28,445,179 I5V probably benign Het
Fscn2 C A 11: 120,362,509 N267K probably damaging Het
Fubp3 A G 2: 31,598,620 T163A probably benign Het
Gm498 T C 7: 143,896,365 S285P probably damaging Het
Gm813 G T 16: 58,615,728 C77* probably null Het
Gne A G 4: 44,040,361 L601P possibly damaging Het
Gphn T C 12: 78,683,889 V766A possibly damaging Het
Hsf1 G T 15: 76,500,021 G402C probably damaging Het
Ift81 A T 5: 122,555,533 Y604* probably null Het
Iqgap3 T A 3: 88,102,063 I768N probably damaging Het
Kazald1 A T 19: 45,078,416 D218V probably benign Het
Kmt2a T C 9: 44,810,721 N3776D unknown Het
Ktn1 T C 14: 47,706,410 L872S probably damaging Het
Lama3 T G 18: 12,404,076 F259L probably benign Het
Mfsd6 A G 1: 52,662,388 probably null Het
Mical3 A T 6: 120,973,733 probably null Het
Mob3b A G 4: 35,083,839 Y117H probably damaging Het
Mrpl2 G A 17: 46,648,255 G95D probably damaging Het
Mta3 C T 17: 83,714,662 R49W probably damaging Het
Mylk3 A G 8: 85,350,485 F574L probably damaging Het
Naca T A 10: 128,040,121 S341T unknown Het
Ncoa1 T C 12: 4,249,722 D1401G probably benign Het
Nedd4 T A 9: 72,670,099 Y69N probably benign Het
Nin T C 12: 70,044,239 T801A Het
Nsd1 T A 13: 55,261,626 L1336* probably null Het
Olfr1138 C T 2: 87,737,712 G204D probably damaging Het
Olfr1257 A G 2: 89,880,841 N5S probably benign Het
Olfr1257 A T 2: 89,881,053 T76S possibly damaging Het
Oprk1 G A 1: 5,602,396 R252H probably damaging Het
Pcdhga11 T C 18: 37,756,664 F242L probably damaging Het
Pof1b A G X: 112,644,345 I544T probably benign Het
Pold1 T C 7: 44,542,148 H138R possibly damaging Het
Ptprd A T 4: 76,071,962 D504E probably benign Het
Rabgap1l A G 1: 160,645,365 V501A probably damaging Het
Rimklb T C 6: 122,452,738 N233S probably benign Het
Rnf213 A G 11: 119,452,575 I3589V Het
Rora T A 9: 69,373,190 C348* probably null Het
Sdhaf3 T C 6: 6,956,043 V6A probably benign Het
Serpina3m T A 12: 104,389,518 L148Q probably damaging Het
Sik1 T C 17: 31,848,772 D443G possibly damaging Het
Sim2 A G 16: 94,122,700 T366A probably benign Het
Slc32a1 T C 2: 158,611,323 F28L probably damaging Het
Sorbs1 A T 19: 40,326,129 Y746* probably null Het
Speer4b T A 5: 27,498,823 N106I possibly damaging Het
Sphkap A G 1: 83,265,985 S1269P probably damaging Het
Tcf4 T C 18: 69,633,578 V205A probably damaging Het
Thsd7a C T 6: 12,352,091 R1035H Het
Tmprss11c A T 5: 86,237,619 probably null Het
Trim50 A G 5: 135,367,511 T438A probably benign Het
Ttc21a C T 9: 119,945,541 P287L probably damaging Het
Ttc41 C T 10: 86,713,503 S187L probably benign Het
Ttll3 C T 6: 113,413,878 P807L probably benign Het
Ttn A C 2: 76,767,352 V19739G probably benign Het
Usp15 C A 10: 123,171,195 C127F probably damaging Het
Vmn2r100 G T 17: 19,531,971 A822S probably benign Het
Zan A T 5: 137,463,494 V1141D unknown Het
Zfp457 A T 13: 67,294,177 C111* probably null Het
Zfp758 C T 17: 22,375,135 Q201* probably null Het
Zkscan2 T C 7: 123,499,807 E54G possibly damaging Het
Other mutations in Mstn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Mstn APN 1 53061997 missense possibly damaging 0.47
IGL01432:Mstn APN 1 53066530 missense possibly damaging 0.65
IGL02009:Mstn APN 1 53062150 splice site probably benign
IGL02547:Mstn APN 1 53064125 missense probably benign 0.08
PIT4403001:Mstn UTSW 1 53061785 missense probably benign 0.00
R0499:Mstn UTSW 1 53063984 missense probably damaging 1.00
R0556:Mstn UTSW 1 53064125 missense probably benign 0.08
R0730:Mstn UTSW 1 53061794 missense possibly damaging 0.81
R1180:Mstn UTSW 1 53064008 missense possibly damaging 0.93
R1472:Mstn UTSW 1 53061998 missense probably damaging 0.99
R1659:Mstn UTSW 1 53064077 nonsense probably null
R1676:Mstn UTSW 1 53062065 missense probably benign 0.08
R1753:Mstn UTSW 1 53066558 missense probably damaging 1.00
R3852:Mstn UTSW 1 53061971 missense possibly damaging 0.78
R4773:Mstn UTSW 1 53062108 missense probably benign 0.18
R4938:Mstn UTSW 1 53066423 missense possibly damaging 0.90
R6000:Mstn UTSW 1 53061669 start gained probably benign
R6393:Mstn UTSW 1 53066489 missense probably benign 0.00
R6991:Mstn UTSW 1 53061941 missense probably benign 0.02
R7018:Mstn UTSW 1 53064084 missense possibly damaging 0.51
R7077:Mstn UTSW 1 53064249 missense probably benign 0.30
R7300:Mstn UTSW 1 53064080 missense probably benign 0.13
R7486:Mstn UTSW 1 53063969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGGATTTCAGGCTCTATTTAC -3'
(R):5'- CTACTACCATGGCTGGAATTTTCC -3'

Sequencing Primer
(F):5'- AGACTTTGGGCTTGACTG -3'
(R):5'- GACATTTTTGTCGGAGTGC -3'
Posted On2019-06-26