Incidental Mutation 'R7170:Olfr1257'
ID558169
Institutional Source Beutler Lab
Gene Symbol Olfr1257
Ensembl Gene ENSMUSG00000049057
Gene Nameolfactory receptor 1257
SynonymsMOR232-1, GA_x6K02T2Q125-51319458-51320387
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R7170 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89878437-89883026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89880841 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 5 (N5S)
Ref Sequence ENSEMBL: ENSMUSP00000107144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060795] [ENSMUST00000111519]
Predicted Effect probably benign
Transcript: ENSMUST00000060795
AA Change: N5S

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000056439
Gene: ENSMUSG00000049057
AA Change: N5S

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 2.6e-31 PFAM
Pfam:7tm_4 137 278 8e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111519
AA Change: N5S

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107144
Gene: ENSMUSG00000049057
AA Change: N5S

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.5e-49 PFAM
Pfam:7tm_1 39 285 3.9e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik C A 9: 105,143,401 probably null Het
Abca8b T C 11: 109,945,828 T1214A probably benign Het
Adgrf5 G A 17: 43,446,138 V708M possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd7 T A 6: 18,868,390 Y170* probably null Het
Aplp2 T C 9: 31,170,443 D236G probably benign Het
Apoa5 T C 9: 46,270,139 M171T probably benign Het
Bcas3 T C 11: 85,495,918 V393A probably damaging Het
Ccdc47 T C 11: 106,202,478 N370S probably benign Het
Cfap77 A T 2: 28,985,842 Y85* probably null Het
Col4a3 G A 1: 82,715,909 probably null Het
Crnn T A 3: 93,148,713 S269T possibly damaging Het
Crocc2 G A 1: 93,193,982 A618T possibly damaging Het
D030056L22Rik A G 19: 18,713,373 K17R possibly damaging Het
Emx1 G A 6: 85,188,001 G20D probably benign Het
Fabp3 A G 4: 130,313,970 D88G probably benign Het
Fam124a A C 14: 62,587,180 D41A probably damaging Het
Fam198a G T 9: 121,978,235 A482S probably damaging Het
Fanca T C 8: 123,271,206 E1247G probably damaging Het
Fat3 T C 9: 16,006,574 R1518G probably damaging Het
Fgf12 T C 16: 28,445,179 I5V probably benign Het
Fscn2 C A 11: 120,362,509 N267K probably damaging Het
Fubp3 A G 2: 31,598,620 T163A probably benign Het
Gm498 T C 7: 143,896,365 S285P probably damaging Het
Gm813 G T 16: 58,615,728 C77* probably null Het
Gne A G 4: 44,040,361 L601P possibly damaging Het
Gphn T C 12: 78,683,889 V766A possibly damaging Het
Hsf1 G T 15: 76,500,021 G402C probably damaging Het
Ift81 A T 5: 122,555,533 Y604* probably null Het
Iqgap3 T A 3: 88,102,063 I768N probably damaging Het
Kazald1 A T 19: 45,078,416 D218V probably benign Het
Kmt2a T C 9: 44,810,721 N3776D unknown Het
Ktn1 T C 14: 47,706,410 L872S probably damaging Het
Lama3 T G 18: 12,404,076 F259L probably benign Het
Mfsd6 A G 1: 52,662,388 probably null Het
Mical3 A T 6: 120,973,733 probably null Het
Mob3b A G 4: 35,083,839 Y117H probably damaging Het
Mrpl2 G A 17: 46,648,255 G95D probably damaging Het
Mstn A T 1: 53,066,395 I299F probably damaging Het
Mta3 C T 17: 83,714,662 R49W probably damaging Het
Mylk3 A G 8: 85,350,485 F574L probably damaging Het
Naca T A 10: 128,040,121 S341T unknown Het
Ncoa1 T C 12: 4,249,722 D1401G probably benign Het
Nedd4 T A 9: 72,670,099 Y69N probably benign Het
Nin T C 12: 70,044,239 T801A Het
Nsd1 T A 13: 55,261,626 L1336* probably null Het
Olfr1138 C T 2: 87,737,712 G204D probably damaging Het
Oprk1 G A 1: 5,602,396 R252H probably damaging Het
Pcdhga11 T C 18: 37,756,664 F242L probably damaging Het
Pof1b A G X: 112,644,345 I544T probably benign Het
Pold1 T C 7: 44,542,148 H138R possibly damaging Het
Ptprd A T 4: 76,071,962 D504E probably benign Het
Rabgap1l A G 1: 160,645,365 V501A probably damaging Het
Rimklb T C 6: 122,452,738 N233S probably benign Het
Rnf213 A G 11: 119,452,575 I3589V Het
Rora T A 9: 69,373,190 C348* probably null Het
Sdhaf3 T C 6: 6,956,043 V6A probably benign Het
Serpina3m T A 12: 104,389,518 L148Q probably damaging Het
Sik1 T C 17: 31,848,772 D443G possibly damaging Het
Sim2 A G 16: 94,122,700 T366A probably benign Het
Slc32a1 T C 2: 158,611,323 F28L probably damaging Het
Sorbs1 A T 19: 40,326,129 Y746* probably null Het
Speer4b T A 5: 27,498,823 N106I possibly damaging Het
Sphkap A G 1: 83,265,985 S1269P probably damaging Het
Tcf4 T C 18: 69,633,578 V205A probably damaging Het
Thsd7a C T 6: 12,352,091 R1035H Het
Tmprss11c A T 5: 86,237,619 probably null Het
Trim50 A G 5: 135,367,511 T438A probably benign Het
Ttc21a C T 9: 119,945,541 P287L probably damaging Het
Ttc41 C T 10: 86,713,503 S187L probably benign Het
Ttll3 C T 6: 113,413,878 P807L probably benign Het
Ttn A C 2: 76,767,352 V19739G probably benign Het
Usp15 C A 10: 123,171,195 C127F probably damaging Het
Vmn2r100 G T 17: 19,531,971 A822S probably benign Het
Zan A T 5: 137,463,494 V1141D unknown Het
Zfp457 A T 13: 67,294,177 C111* probably null Het
Zfp758 C T 17: 22,375,135 Q201* probably null Het
Zkscan2 T C 7: 123,499,807 E54G possibly damaging Het
Other mutations in Olfr1257
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01600:Olfr1257 APN 2 89881662 missense probably benign 0.02
IGL01641:Olfr1257 APN 2 89881608 missense probably benign 0.01
IGL01668:Olfr1257 APN 2 89881099 missense probably benign 0.01
IGL01901:Olfr1257 APN 2 89881482 missense probably damaging 1.00
IGL02401:Olfr1257 APN 2 89881453 missense probably damaging 1.00
IGL02472:Olfr1257 APN 2 89881411 missense probably benign 0.44
IGL02631:Olfr1257 APN 2 89881255 missense possibly damaging 0.95
PIT4354001:Olfr1257 UTSW 2 89881508 missense probably benign 0.04
R0552:Olfr1257 UTSW 2 89880891 nonsense probably null
R0616:Olfr1257 UTSW 2 89881591 missense probably benign 0.07
R0943:Olfr1257 UTSW 2 89880961 missense probably benign 0.11
R1146:Olfr1257 UTSW 2 89881206 missense probably damaging 1.00
R1146:Olfr1257 UTSW 2 89881206 missense probably damaging 1.00
R1314:Olfr1257 UTSW 2 89880877 missense probably benign 0.35
R1641:Olfr1257 UTSW 2 89881401 missense probably benign 0.07
R1763:Olfr1257 UTSW 2 89881129 missense probably damaging 0.99
R1836:Olfr1257 UTSW 2 89881285 missense probably damaging 1.00
R2125:Olfr1257 UTSW 2 89881638 missense probably benign
R4322:Olfr1257 UTSW 2 89881734 missense probably benign 0.07
R4897:Olfr1257 UTSW 2 89881132 missense probably benign 0.39
R5446:Olfr1257 UTSW 2 89881549 missense probably damaging 1.00
R5456:Olfr1257 UTSW 2 89881258 missense probably damaging 0.97
R6415:Olfr1257 UTSW 2 89880862 missense probably damaging 1.00
R6905:Olfr1257 UTSW 2 89881708 missense probably benign 0.05
R7170:Olfr1257 UTSW 2 89881053 missense possibly damaging 0.70
R7411:Olfr1257 UTSW 2 89881261 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTCCCGCACACTTATAAAAGTTCC -3'
(R):5'- TCAGTTTAGGGGTGCTAACAGAG -3'

Sequencing Primer
(F):5'- TTAACAGAGTTGTCACCTAAAAACCG -3'
(R):5'- TGCTAACAGAGGAATAGCAAGCATC -3'
Posted On2019-06-26