Incidental Mutation 'R7170:Ankrd7'
ID558186
Institutional Source Beutler Lab
Gene Symbol Ankrd7
Ensembl Gene ENSMUSG00000029517
Gene Nameankyrin repeat domain 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7170 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location18866318-18879586 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 18868390 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 170 (Y170*)
Ref Sequence ENSEMBL: ENSMUSP00000111054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031489] [ENSMUST00000115396]
Predicted Effect probably null
Transcript: ENSMUST00000031489
AA Change: Y169*
SMART Domains Protein: ENSMUSP00000031489
Gene: ENSMUSG00000029517
AA Change: Y169*

DomainStartEndE-ValueType
low complexity region 46 55 N/A INTRINSIC
ANK 80 109 1.06e-4 SMART
ANK 113 142 5.45e-2 SMART
ANK 146 175 6.92e-4 SMART
ANK 179 208 1.94e-7 SMART
ANK 212 241 1.99e2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115396
AA Change: Y170*
SMART Domains Protein: ENSMUSP00000111054
Gene: ENSMUSG00000029517
AA Change: Y170*

DomainStartEndE-ValueType
low complexity region 46 55 N/A INTRINSIC
ANK 80 109 1.06e-4 SMART
ANK 113 143 3.07e2 SMART
ANK 147 176 6.92e-4 SMART
ANK 180 209 1.94e-7 SMART
ANK 213 242 1.99e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (81/81)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik C A 9: 105,143,401 probably null Het
Abca8b T C 11: 109,945,828 T1214A probably benign Het
Adgrf5 G A 17: 43,446,138 V708M possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Aplp2 T C 9: 31,170,443 D236G probably benign Het
Apoa5 T C 9: 46,270,139 M171T probably benign Het
Bcas3 T C 11: 85,495,918 V393A probably damaging Het
Ccdc47 T C 11: 106,202,478 N370S probably benign Het
Cfap77 A T 2: 28,985,842 Y85* probably null Het
Col4a3 G A 1: 82,715,909 probably null Het
Crnn T A 3: 93,148,713 S269T possibly damaging Het
Crocc2 G A 1: 93,193,982 A618T possibly damaging Het
D030056L22Rik A G 19: 18,713,373 K17R possibly damaging Het
Emx1 G A 6: 85,188,001 G20D probably benign Het
Fabp3 A G 4: 130,313,970 D88G probably benign Het
Fam124a A C 14: 62,587,180 D41A probably damaging Het
Fam198a G T 9: 121,978,235 A482S probably damaging Het
Fanca T C 8: 123,271,206 E1247G probably damaging Het
Fat3 T C 9: 16,006,574 R1518G probably damaging Het
Fgf12 T C 16: 28,445,179 I5V probably benign Het
Fscn2 C A 11: 120,362,509 N267K probably damaging Het
Fubp3 A G 2: 31,598,620 T163A probably benign Het
Gm498 T C 7: 143,896,365 S285P probably damaging Het
Gm813 G T 16: 58,615,728 C77* probably null Het
Gne A G 4: 44,040,361 L601P possibly damaging Het
Gphn T C 12: 78,683,889 V766A possibly damaging Het
Hsf1 G T 15: 76,500,021 G402C probably damaging Het
Ift81 A T 5: 122,555,533 Y604* probably null Het
Iqgap3 T A 3: 88,102,063 I768N probably damaging Het
Kazald1 A T 19: 45,078,416 D218V probably benign Het
Kmt2a T C 9: 44,810,721 N3776D unknown Het
Ktn1 T C 14: 47,706,410 L872S probably damaging Het
Lama3 T G 18: 12,404,076 F259L probably benign Het
Mfsd6 A G 1: 52,662,388 probably null Het
Mical3 A T 6: 120,973,733 probably null Het
Mob3b A G 4: 35,083,839 Y117H probably damaging Het
Mrpl2 G A 17: 46,648,255 G95D probably damaging Het
Mstn A T 1: 53,066,395 I299F probably damaging Het
Mta3 C T 17: 83,714,662 R49W probably damaging Het
Mylk3 A G 8: 85,350,485 F574L probably damaging Het
Naca T A 10: 128,040,121 S341T unknown Het
Ncoa1 T C 12: 4,249,722 D1401G probably benign Het
Nedd4 T A 9: 72,670,099 Y69N probably benign Het
Nin T C 12: 70,044,239 T801A Het
Nsd1 T A 13: 55,261,626 L1336* probably null Het
Olfr1138 C T 2: 87,737,712 G204D probably damaging Het
Olfr1257 A G 2: 89,880,841 N5S probably benign Het
Olfr1257 A T 2: 89,881,053 T76S possibly damaging Het
Oprk1 G A 1: 5,602,396 R252H probably damaging Het
Pcdhga11 T C 18: 37,756,664 F242L probably damaging Het
Pof1b A G X: 112,644,345 I544T probably benign Het
Pold1 T C 7: 44,542,148 H138R possibly damaging Het
Ptprd A T 4: 76,071,962 D504E probably benign Het
Rabgap1l A G 1: 160,645,365 V501A probably damaging Het
Rimklb T C 6: 122,452,738 N233S probably benign Het
Rnf213 A G 11: 119,452,575 I3589V Het
Rora T A 9: 69,373,190 C348* probably null Het
Sdhaf3 T C 6: 6,956,043 V6A probably benign Het
Serpina3m T A 12: 104,389,518 L148Q probably damaging Het
Sik1 T C 17: 31,848,772 D443G possibly damaging Het
Sim2 A G 16: 94,122,700 T366A probably benign Het
Slc32a1 T C 2: 158,611,323 F28L probably damaging Het
Sorbs1 A T 19: 40,326,129 Y746* probably null Het
Speer4b T A 5: 27,498,823 N106I possibly damaging Het
Sphkap A G 1: 83,265,985 S1269P probably damaging Het
Tcf4 T C 18: 69,633,578 V205A probably damaging Het
Thsd7a C T 6: 12,352,091 R1035H Het
Tmprss11c A T 5: 86,237,619 probably null Het
Trim50 A G 5: 135,367,511 T438A probably benign Het
Ttc21a C T 9: 119,945,541 P287L probably damaging Het
Ttc41 C T 10: 86,713,503 S187L probably benign Het
Ttll3 C T 6: 113,413,878 P807L probably benign Het
Ttn A C 2: 76,767,352 V19739G probably benign Het
Usp15 C A 10: 123,171,195 C127F probably damaging Het
Vmn2r100 G T 17: 19,531,971 A822S probably benign Het
Zan A T 5: 137,463,494 V1141D unknown Het
Zfp457 A T 13: 67,294,177 C111* probably null Het
Zfp758 C T 17: 22,375,135 Q201* probably null Het
Zkscan2 T C 7: 123,499,807 E54G possibly damaging Het
Other mutations in Ankrd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Ankrd7 APN 6 18879346 missense probably damaging 0.99
IGL01336:Ankrd7 APN 6 18868278 missense probably benign 0.05
IGL01916:Ankrd7 APN 6 18868251 missense possibly damaging 0.65
IGL02398:Ankrd7 APN 6 18866697 missense probably damaging 0.99
R0031:Ankrd7 UTSW 6 18870008 nonsense probably null
R0157:Ankrd7 UTSW 6 18866540 missense probably damaging 0.98
R0207:Ankrd7 UTSW 6 18870031 missense probably benign 0.09
R2154:Ankrd7 UTSW 6 18870031 missense probably benign 0.09
R4255:Ankrd7 UTSW 6 18869881 splice site probably null
R4581:Ankrd7 UTSW 6 18868021 missense probably damaging 0.99
R4582:Ankrd7 UTSW 6 18868021 missense probably damaging 0.99
R4958:Ankrd7 UTSW 6 18866723 missense probably benign 0.05
R5194:Ankrd7 UTSW 6 18868077 missense possibly damaging 0.67
R6077:Ankrd7 UTSW 6 18868072 missense probably benign 0.08
R6731:Ankrd7 UTSW 6 18866654 missense probably damaging 1.00
R6898:Ankrd7 UTSW 6 18868101 splice site probably null
R7194:Ankrd7 UTSW 6 18879343 missense probably benign 0.00
RF012:Ankrd7 UTSW 6 18869275 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GAACCCCATTGATTAAGGTGTGTTC -3'
(R):5'- GGATTAAGGTCTACAATGAAAGGTC -3'

Sequencing Primer
(F):5'- GGAAGTTGTCCACTCATTTATTCTTG -3'
(R):5'- AGGTCTACAATGAAAGGTCTAAAATG -3'
Posted On2019-06-26