Incidental Mutation 'R7170:Zkscan2'
ID558190
Institutional Source Beutler Lab
Gene Symbol Zkscan2
Ensembl Gene ENSMUSG00000030757
Gene Namezinc finger with KRAB and SCAN domains 2
Synonyms9430065N20Rik, Zfp694
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R7170 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location123475384-123500449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123499807 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 54 (E54G)
Ref Sequence ENSEMBL: ENSMUSP00000041821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042470] [ENSMUST00000128217]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042470
AA Change: E54G

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041821
Gene: ENSMUSG00000030757
AA Change: E54G

DomainStartEndE-ValueType
SCAN 41 148 1.62e-54 SMART
KRAB 222 282 1.71e-2 SMART
SANT 333 397 3.73e0 SMART
low complexity region 449 469 N/A INTRINSIC
SANT 489 553 2.18e0 SMART
low complexity region 627 649 N/A INTRINSIC
ZnF_C2H2 768 790 6.42e-4 SMART
ZnF_C2H2 796 818 7.9e-4 SMART
ZnF_C2H2 824 846 5.99e-4 SMART
ZnF_C2H2 852 874 3.21e-4 SMART
ZnF_C2H2 880 902 1.18e-2 SMART
ZnF_C2H2 908 930 8.81e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128217
AA Change: E54G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134381
Gene: ENSMUSG00000030757
AA Change: E54G

DomainStartEndE-ValueType
SCAN 41 148 1.62e-54 SMART
Meta Mutation Damage Score 0.1253 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (81/81)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik C A 9: 105,143,401 probably null Het
Abca8b T C 11: 109,945,828 T1214A probably benign Het
Adgrf5 G A 17: 43,446,138 V708M possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd7 T A 6: 18,868,390 Y170* probably null Het
Aplp2 T C 9: 31,170,443 D236G probably benign Het
Apoa5 T C 9: 46,270,139 M171T probably benign Het
Bcas3 T C 11: 85,495,918 V393A probably damaging Het
Ccdc47 T C 11: 106,202,478 N370S probably benign Het
Cfap77 A T 2: 28,985,842 Y85* probably null Het
Col4a3 G A 1: 82,715,909 probably null Het
Crnn T A 3: 93,148,713 S269T possibly damaging Het
Crocc2 G A 1: 93,193,982 A618T possibly damaging Het
D030056L22Rik A G 19: 18,713,373 K17R possibly damaging Het
Emx1 G A 6: 85,188,001 G20D probably benign Het
Fabp3 A G 4: 130,313,970 D88G probably benign Het
Fam124a A C 14: 62,587,180 D41A probably damaging Het
Fam198a G T 9: 121,978,235 A482S probably damaging Het
Fanca T C 8: 123,271,206 E1247G probably damaging Het
Fat3 T C 9: 16,006,574 R1518G probably damaging Het
Fgf12 T C 16: 28,445,179 I5V probably benign Het
Fscn2 C A 11: 120,362,509 N267K probably damaging Het
Fubp3 A G 2: 31,598,620 T163A probably benign Het
Gm498 T C 7: 143,896,365 S285P probably damaging Het
Gm813 G T 16: 58,615,728 C77* probably null Het
Gne A G 4: 44,040,361 L601P possibly damaging Het
Gphn T C 12: 78,683,889 V766A possibly damaging Het
Hsf1 G T 15: 76,500,021 G402C probably damaging Het
Ift81 A T 5: 122,555,533 Y604* probably null Het
Iqgap3 T A 3: 88,102,063 I768N probably damaging Het
Kazald1 A T 19: 45,078,416 D218V probably benign Het
Kmt2a T C 9: 44,810,721 N3776D unknown Het
Ktn1 T C 14: 47,706,410 L872S probably damaging Het
Lama3 T G 18: 12,404,076 F259L probably benign Het
Mfsd6 A G 1: 52,662,388 probably null Het
Mical3 A T 6: 120,973,733 probably null Het
Mob3b A G 4: 35,083,839 Y117H probably damaging Het
Mrpl2 G A 17: 46,648,255 G95D probably damaging Het
Mstn A T 1: 53,066,395 I299F probably damaging Het
Mta3 C T 17: 83,714,662 R49W probably damaging Het
Mylk3 A G 8: 85,350,485 F574L probably damaging Het
Naca T A 10: 128,040,121 S341T unknown Het
Ncoa1 T C 12: 4,249,722 D1401G probably benign Het
Nedd4 T A 9: 72,670,099 Y69N probably benign Het
Nin T C 12: 70,044,239 T801A Het
Nsd1 T A 13: 55,261,626 L1336* probably null Het
Olfr1138 C T 2: 87,737,712 G204D probably damaging Het
Olfr1257 A G 2: 89,880,841 N5S probably benign Het
Olfr1257 A T 2: 89,881,053 T76S possibly damaging Het
Oprk1 G A 1: 5,602,396 R252H probably damaging Het
Pcdhga11 T C 18: 37,756,664 F242L probably damaging Het
Pof1b A G X: 112,644,345 I544T probably benign Het
Pold1 T C 7: 44,542,148 H138R possibly damaging Het
Ptprd A T 4: 76,071,962 D504E probably benign Het
Rabgap1l A G 1: 160,645,365 V501A probably damaging Het
Rimklb T C 6: 122,452,738 N233S probably benign Het
Rnf213 A G 11: 119,452,575 I3589V Het
Rora T A 9: 69,373,190 C348* probably null Het
Sdhaf3 T C 6: 6,956,043 V6A probably benign Het
Serpina3m T A 12: 104,389,518 L148Q probably damaging Het
Sik1 T C 17: 31,848,772 D443G possibly damaging Het
Sim2 A G 16: 94,122,700 T366A probably benign Het
Slc32a1 T C 2: 158,611,323 F28L probably damaging Het
Sorbs1 A T 19: 40,326,129 Y746* probably null Het
Speer4b T A 5: 27,498,823 N106I possibly damaging Het
Sphkap A G 1: 83,265,985 S1269P probably damaging Het
Tcf4 T C 18: 69,633,578 V205A probably damaging Het
Thsd7a C T 6: 12,352,091 R1035H Het
Tmprss11c A T 5: 86,237,619 probably null Het
Trim50 A G 5: 135,367,511 T438A probably benign Het
Ttc21a C T 9: 119,945,541 P287L probably damaging Het
Ttc41 C T 10: 86,713,503 S187L probably benign Het
Ttll3 C T 6: 113,413,878 P807L probably benign Het
Ttn A C 2: 76,767,352 V19739G probably benign Het
Usp15 C A 10: 123,171,195 C127F probably damaging Het
Vmn2r100 G T 17: 19,531,971 A822S probably benign Het
Zan A T 5: 137,463,494 V1141D unknown Het
Zfp457 A T 13: 67,294,177 C111* probably null Het
Zfp758 C T 17: 22,375,135 Q201* probably null Het
Other mutations in Zkscan2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Zkscan2 APN 7 123479972 missense probably damaging 1.00
IGL02098:Zkscan2 APN 7 123499841 missense probably benign 0.02
IGL03093:Zkscan2 APN 7 123494850 missense probably benign 0.01
R0016:Zkscan2 UTSW 7 123499996 start gained probably benign
R0135:Zkscan2 UTSW 7 123480641 missense possibly damaging 0.63
R0541:Zkscan2 UTSW 7 123480200 missense possibly damaging 0.92
R0569:Zkscan2 UTSW 7 123498675 missense probably benign 0.11
R1537:Zkscan2 UTSW 7 123499841 missense possibly damaging 0.95
R1726:Zkscan2 UTSW 7 123489823 missense probably damaging 1.00
R3792:Zkscan2 UTSW 7 123485002 missense possibly damaging 0.95
R3802:Zkscan2 UTSW 7 123495142 intron probably benign
R3803:Zkscan2 UTSW 7 123495142 intron probably benign
R3804:Zkscan2 UTSW 7 123495142 intron probably benign
R4012:Zkscan2 UTSW 7 123498660 missense possibly damaging 0.76
R4111:Zkscan2 UTSW 7 123482684 intron probably benign
R4605:Zkscan2 UTSW 7 123498724 missense probably damaging 1.00
R4978:Zkscan2 UTSW 7 123495319 missense possibly damaging 0.86
R5004:Zkscan2 UTSW 7 123490044 missense probably damaging 1.00
R5163:Zkscan2 UTSW 7 123499867 missense probably benign 0.01
R5753:Zkscan2 UTSW 7 123480700 missense probably benign
R5830:Zkscan2 UTSW 7 123480100 missense possibly damaging 0.47
R6153:Zkscan2 UTSW 7 123489770 missense probably benign 0.06
R6912:Zkscan2 UTSW 7 123499973 start gained probably benign
R7269:Zkscan2 UTSW 7 123489771 missense probably benign
R7310:Zkscan2 UTSW 7 123490053 missense possibly damaging 0.53
R7399:Zkscan2 UTSW 7 123480104 missense probably damaging 0.98
R7624:Zkscan2 UTSW 7 123498771 missense probably damaging 0.97
R7687:Zkscan2 UTSW 7 123499862 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACCTGCTTTCGAAGTCTTCTGG -3'
(R):5'- CCCATTGGATCATGGCTACTG -3'

Sequencing Primer
(F):5'- TTCTCCAAATGCACTACTAGGG -3'
(R):5'- ATGGCTACTGTCATGAACCCTCAG -3'
Posted On2019-06-26