Incidental Mutation 'R7170:Kmt2a'
ID558196
Institutional Source Beutler Lab
Gene Symbol Kmt2a
Ensembl Gene ENSMUSG00000002028
Gene Namelysine (K)-specific methyltransferase 2A
SynonymsMll1, HTRX1, ALL-1, Cxxc7, trithorax Drosophila, Mll, All1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7170 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location44803355-44881296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44810721 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 3776 (N3776D)
Ref Sequence ENSEMBL: ENSMUSP00000110337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002095] [ENSMUST00000114689]
Predicted Effect unknown
Transcript: ENSMUST00000002095
AA Change: N3773D
SMART Domains Protein: ENSMUSP00000002095
Gene: ENSMUSG00000002028
AA Change: N3773D

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 41 102 N/A INTRINSIC
PDB:3U88|N 103 151 6e-15 PDB
AT_hook 171 183 2.12e2 SMART
AT_hook 217 229 4.68e1 SMART
AT_hook 298 310 2.8e0 SMART
coiled coil region 366 394 N/A INTRINSIC
low complexity region 450 489 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 544 574 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 760 790 N/A INTRINSIC
low complexity region 866 892 N/A INTRINSIC
low complexity region 989 1005 N/A INTRINSIC
Pfam:zf-CXXC 1144 1191 1.1e-15 PFAM
low complexity region 1204 1233 N/A INTRINSIC
low complexity region 1236 1283 N/A INTRINSIC
low complexity region 1295 1316 N/A INTRINSIC
low complexity region 1323 1345 N/A INTRINSIC
low complexity region 1353 1366 N/A INTRINSIC
PHD 1432 1479 5.57e-3 SMART
PHD 1480 1530 1.17e-10 SMART
PHD 1567 1624 7.94e-8 SMART
BROMO 1632 1766 2.24e-10 SMART
low complexity region 1816 1850 N/A INTRINSIC
PHD 1931 1977 1.74e-4 SMART
low complexity region 1990 2001 N/A INTRINSIC
FYRN 2029 2072 2.33e-20 SMART
low complexity region 2180 2194 N/A INTRINSIC
low complexity region 2215 2227 N/A INTRINSIC
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2789 2800 N/A INTRINSIC
low complexity region 2824 2833 N/A INTRINSIC
low complexity region 2856 2878 N/A INTRINSIC
low complexity region 2902 2909 N/A INTRINSIC
low complexity region 3115 3141 N/A INTRINSIC
low complexity region 3164 3175 N/A INTRINSIC
low complexity region 3228 3239 N/A INTRINSIC
low complexity region 3299 3312 N/A INTRINSIC
low complexity region 3342 3351 N/A INTRINSIC
low complexity region 3405 3419 N/A INTRINSIC
low complexity region 3498 3526 N/A INTRINSIC
low complexity region 3620 3633 N/A INTRINSIC
FYRC 3662 3747 8.54e-37 SMART
SET 3823 3945 6.09e-45 SMART
PostSET 3947 3963 1.65e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114689
AA Change: N3776D
SMART Domains Protein: ENSMUSP00000110337
Gene: ENSMUSG00000002028
AA Change: N3776D

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 41 102 N/A INTRINSIC
PDB:3U88|N 103 151 6e-15 PDB
AT_hook 171 183 2.12e2 SMART
AT_hook 217 229 4.68e1 SMART
AT_hook 298 310 2.8e0 SMART
coiled coil region 366 394 N/A INTRINSIC
low complexity region 450 489 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 544 574 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 760 790 N/A INTRINSIC
low complexity region 866 892 N/A INTRINSIC
low complexity region 989 1005 N/A INTRINSIC
Pfam:zf-CXXC 1144 1191 1.1e-15 PFAM
low complexity region 1204 1233 N/A INTRINSIC
low complexity region 1236 1283 N/A INTRINSIC
low complexity region 1295 1316 N/A INTRINSIC
low complexity region 1323 1345 N/A INTRINSIC
low complexity region 1353 1366 N/A INTRINSIC
PHD 1432 1479 5.57e-3 SMART
PHD 1480 1530 1.17e-10 SMART
PHD 1567 1627 9.12e-8 SMART
BROMO 1635 1769 2.24e-10 SMART
low complexity region 1819 1853 N/A INTRINSIC
PHD 1934 1980 1.74e-4 SMART
low complexity region 1993 2004 N/A INTRINSIC
FYRN 2032 2075 2.33e-20 SMART
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2218 2230 N/A INTRINSIC
low complexity region 2610 2621 N/A INTRINSIC
low complexity region 2792 2803 N/A INTRINSIC
low complexity region 2827 2836 N/A INTRINSIC
low complexity region 2859 2881 N/A INTRINSIC
low complexity region 2905 2912 N/A INTRINSIC
low complexity region 3118 3144 N/A INTRINSIC
low complexity region 3167 3178 N/A INTRINSIC
low complexity region 3231 3242 N/A INTRINSIC
low complexity region 3302 3315 N/A INTRINSIC
low complexity region 3345 3354 N/A INTRINSIC
low complexity region 3408 3422 N/A INTRINSIC
low complexity region 3501 3529 N/A INTRINSIC
low complexity region 3623 3636 N/A INTRINSIC
FYRC 3665 3750 8.54e-37 SMART
SET 3826 3948 6.09e-45 SMART
PostSET 3950 3966 1.65e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138119
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional coactivator that plays an essential role in regulating gene expression during early development and hematopoiesis. The encoded protein contains multiple conserved functional domains. One of these domains, the SET domain, is responsible for its histone H3 lysine 4 (H3K4) methyltransferase activity which mediates chromatin modifications associated with epigenetic transcriptional activation. This protein is processed by the enzyme Taspase 1 into two fragments, MLL-C and MLL-N. These fragments reassociate and further assemble into different multiprotein complexes that regulate the transcription of specific target genes, including many of the HOX genes. Multiple chromosomal translocations involving this gene are the cause of certain acute lymphoid leukemias and acute myeloid leukemias. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygotes for targeted null mutations die at embryonic day 11.5-14.5 with edematous bodies, petechiae, and hematopoietic insufficiency. Heterozygotes show reduced growth, hematopoietic abnormalities, and homeotic transformations of the axial skeleton. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik C A 9: 105,143,401 probably null Het
Abca8b T C 11: 109,945,828 T1214A probably benign Het
Adgrf5 G A 17: 43,446,138 V708M possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd7 T A 6: 18,868,390 Y170* probably null Het
Aplp2 T C 9: 31,170,443 D236G probably benign Het
Apoa5 T C 9: 46,270,139 M171T probably benign Het
Bcas3 T C 11: 85,495,918 V393A probably damaging Het
Ccdc47 T C 11: 106,202,478 N370S probably benign Het
Cfap77 A T 2: 28,985,842 Y85* probably null Het
Col4a3 G A 1: 82,715,909 probably null Het
Crnn T A 3: 93,148,713 S269T possibly damaging Het
Crocc2 G A 1: 93,193,982 A618T possibly damaging Het
D030056L22Rik A G 19: 18,713,373 K17R possibly damaging Het
Emx1 G A 6: 85,188,001 G20D probably benign Het
Fabp3 A G 4: 130,313,970 D88G probably benign Het
Fam124a A C 14: 62,587,180 D41A probably damaging Het
Fam198a G T 9: 121,978,235 A482S probably damaging Het
Fanca T C 8: 123,271,206 E1247G probably damaging Het
Fat3 T C 9: 16,006,574 R1518G probably damaging Het
Fgf12 T C 16: 28,445,179 I5V probably benign Het
Fscn2 C A 11: 120,362,509 N267K probably damaging Het
Fubp3 A G 2: 31,598,620 T163A probably benign Het
Gm498 T C 7: 143,896,365 S285P probably damaging Het
Gm813 G T 16: 58,615,728 C77* probably null Het
Gne A G 4: 44,040,361 L601P possibly damaging Het
Gphn T C 12: 78,683,889 V766A possibly damaging Het
Hsf1 G T 15: 76,500,021 G402C probably damaging Het
Ift81 A T 5: 122,555,533 Y604* probably null Het
Iqgap3 T A 3: 88,102,063 I768N probably damaging Het
Kazald1 A T 19: 45,078,416 D218V probably benign Het
Ktn1 T C 14: 47,706,410 L872S probably damaging Het
Lama3 T G 18: 12,404,076 F259L probably benign Het
Mfsd6 A G 1: 52,662,388 probably null Het
Mical3 A T 6: 120,973,733 probably null Het
Mob3b A G 4: 35,083,839 Y117H probably damaging Het
Mrpl2 G A 17: 46,648,255 G95D probably damaging Het
Mstn A T 1: 53,066,395 I299F probably damaging Het
Mta3 C T 17: 83,714,662 R49W probably damaging Het
Mylk3 A G 8: 85,350,485 F574L probably damaging Het
Naca T A 10: 128,040,121 S341T unknown Het
Ncoa1 T C 12: 4,249,722 D1401G probably benign Het
Nedd4 T A 9: 72,670,099 Y69N probably benign Het
Nin T C 12: 70,044,239 T801A Het
Nsd1 T A 13: 55,261,626 L1336* probably null Het
Olfr1138 C T 2: 87,737,712 G204D probably damaging Het
Olfr1257 A G 2: 89,880,841 N5S probably benign Het
Olfr1257 A T 2: 89,881,053 T76S possibly damaging Het
Oprk1 G A 1: 5,602,396 R252H probably damaging Het
Pcdhga11 T C 18: 37,756,664 F242L probably damaging Het
Pof1b A G X: 112,644,345 I544T probably benign Het
Pold1 T C 7: 44,542,148 H138R possibly damaging Het
Ptprd A T 4: 76,071,962 D504E probably benign Het
Rabgap1l A G 1: 160,645,365 V501A probably damaging Het
Rimklb T C 6: 122,452,738 N233S probably benign Het
Rnf213 A G 11: 119,452,575 I3589V Het
Rora T A 9: 69,373,190 C348* probably null Het
Sdhaf3 T C 6: 6,956,043 V6A probably benign Het
Serpina3m T A 12: 104,389,518 L148Q probably damaging Het
Sik1 T C 17: 31,848,772 D443G possibly damaging Het
Sim2 A G 16: 94,122,700 T366A probably benign Het
Slc32a1 T C 2: 158,611,323 F28L probably damaging Het
Sorbs1 A T 19: 40,326,129 Y746* probably null Het
Speer4b T A 5: 27,498,823 N106I possibly damaging Het
Sphkap A G 1: 83,265,985 S1269P probably damaging Het
Tcf4 T C 18: 69,633,578 V205A probably damaging Het
Thsd7a C T 6: 12,352,091 R1035H Het
Tmprss11c A T 5: 86,237,619 probably null Het
Trim50 A G 5: 135,367,511 T438A probably benign Het
Ttc21a C T 9: 119,945,541 P287L probably damaging Het
Ttc41 C T 10: 86,713,503 S187L probably benign Het
Ttll3 C T 6: 113,413,878 P807L probably benign Het
Ttn A C 2: 76,767,352 V19739G probably benign Het
Usp15 C A 10: 123,171,195 C127F probably damaging Het
Vmn2r100 G T 17: 19,531,971 A822S probably benign Het
Zan A T 5: 137,463,494 V1141D unknown Het
Zfp457 A T 13: 67,294,177 C111* probably null Het
Zfp758 C T 17: 22,375,135 Q201* probably null Het
Zkscan2 T C 7: 123,499,807 E54G possibly damaging Het
Other mutations in Kmt2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Kmt2a APN 9 44807934 unclassified probably benign
IGL00667:Kmt2a APN 9 44824386 utr 3 prime probably benign
IGL00828:Kmt2a APN 9 44820776 unclassified probably benign
IGL01080:Kmt2a APN 9 44809092 missense unknown
IGL01131:Kmt2a APN 9 44821170 unclassified probably benign
IGL01294:Kmt2a APN 9 44820297 unclassified probably benign
IGL01432:Kmt2a APN 9 44809096 missense unknown
IGL01646:Kmt2a APN 9 44825484 utr 3 prime probably benign
IGL01777:Kmt2a APN 9 44849005 missense probably damaging 0.99
IGL01944:Kmt2a APN 9 44849767 missense probably damaging 1.00
IGL02125:Kmt2a APN 9 44848686 missense probably damaging 1.00
IGL02207:Kmt2a APN 9 44847682 missense probably damaging 0.98
IGL02424:Kmt2a APN 9 44824635 utr 3 prime probably benign
IGL02499:Kmt2a APN 9 44830509 splice site probably benign
IGL02574:Kmt2a APN 9 44830513 splice site probably benign
IGL02711:Kmt2a APN 9 44824523 splice site probably benign
IGL02828:Kmt2a APN 9 44821947 unclassified probably benign
IGL03012:Kmt2a APN 9 44810966 unclassified probably benign
IGL03242:Kmt2a APN 9 44848392 missense probably damaging 0.99
IGL03294:Kmt2a APN 9 44820565 unclassified probably benign
IGL03326:Kmt2a APN 9 44818747 nonsense probably null
Chromas UTSW 9 44820342 unclassified probably benign
Heteros UTSW 9 44828811 nonsense probably null
Pyknos UTSW 9 44826828 utr 3 prime probably benign
Skies UTSW 9 44829261 utr 3 prime probably benign
spacious UTSW 9 44847645 missense probably benign 0.03
PIT4402001:Kmt2a UTSW 9 44841062 missense unknown
R0076:Kmt2a UTSW 9 44830059 utr 3 prime probably benign
R0076:Kmt2a UTSW 9 44830059 utr 3 prime probably benign
R0180:Kmt2a UTSW 9 44826851 utr 3 prime probably benign
R0363:Kmt2a UTSW 9 44809713 critical splice donor site probably null
R0411:Kmt2a UTSW 9 44819964 unclassified probably benign
R0555:Kmt2a UTSW 9 44847571 missense probably damaging 1.00
R0587:Kmt2a UTSW 9 44847534 missense probably damaging 0.99
R0865:Kmt2a UTSW 9 44818770 unclassified probably benign
R0988:Kmt2a UTSW 9 44848549 missense probably benign 0.03
R1006:Kmt2a UTSW 9 44847696 missense probably damaging 0.99
R1108:Kmt2a UTSW 9 44849062 missense probably damaging 1.00
R1292:Kmt2a UTSW 9 44814694 utr 3 prime probably benign
R1322:Kmt2a UTSW 9 44821121 unclassified probably benign
R1476:Kmt2a UTSW 9 44824635 utr 3 prime probably benign
R1485:Kmt2a UTSW 9 44826928 utr 3 prime probably benign
R1487:Kmt2a UTSW 9 44833990 utr 3 prime probably benign
R1493:Kmt2a UTSW 9 44846905 missense probably damaging 1.00
R1499:Kmt2a UTSW 9 44848266 missense probably benign 0.36
R1507:Kmt2a UTSW 9 44818403 unclassified probably benign
R1603:Kmt2a UTSW 9 44841561 unclassified probably null
R1635:Kmt2a UTSW 9 44824369 utr 3 prime probably benign
R1662:Kmt2a UTSW 9 44836670 utr 3 prime probably benign
R1711:Kmt2a UTSW 9 44841621 missense unknown
R1785:Kmt2a UTSW 9 44819675 unclassified probably benign
R1786:Kmt2a UTSW 9 44819675 unclassified probably benign
R1919:Kmt2a UTSW 9 44820345 unclassified probably benign
R1964:Kmt2a UTSW 9 44820644 missense probably benign 0.23
R1965:Kmt2a UTSW 9 44821460 unclassified probably benign
R2029:Kmt2a UTSW 9 44818450 missense probably benign 0.23
R2054:Kmt2a UTSW 9 44823374 utr 3 prime probably benign
R2259:Kmt2a UTSW 9 44881142 unclassified probably benign
R2382:Kmt2a UTSW 9 44820910 unclassified probably benign
R2483:Kmt2a UTSW 9 44848966 missense probably damaging 0.99
R3033:Kmt2a UTSW 9 44821863 unclassified probably benign
R3423:Kmt2a UTSW 9 44820097 unclassified probably benign
R3428:Kmt2a UTSW 9 44848119 missense probably benign 0.06
R3605:Kmt2a UTSW 9 44849196 missense probably damaging 1.00
R3607:Kmt2a UTSW 9 44849196 missense probably damaging 1.00
R3611:Kmt2a UTSW 9 44822466 unclassified probably benign
R3623:Kmt2a UTSW 9 44848966 missense probably damaging 0.99
R3745:Kmt2a UTSW 9 44831340 utr 3 prime probably benign
R3806:Kmt2a UTSW 9 44820356 unclassified probably benign
R3841:Kmt2a UTSW 9 44831291 utr 3 prime probably benign
R3855:Kmt2a UTSW 9 44830499 utr 3 prime probably benign
R4027:Kmt2a UTSW 9 44836693 utr 3 prime probably benign
R4124:Kmt2a UTSW 9 44819796 unclassified probably benign
R4177:Kmt2a UTSW 9 44820983 unclassified probably benign
R4296:Kmt2a UTSW 9 44821175 unclassified probably benign
R4414:Kmt2a UTSW 9 44809780 unclassified probably benign
R4461:Kmt2a UTSW 9 44848966 missense probably damaging 0.99
R4668:Kmt2a UTSW 9 44824572 utr 3 prime probably benign
R4761:Kmt2a UTSW 9 44849124 missense probably damaging 1.00
R4812:Kmt2a UTSW 9 44831354 utr 3 prime probably benign
R4815:Kmt2a UTSW 9 44821256 unclassified probably benign
R4817:Kmt2a UTSW 9 44821466 unclassified probably benign
R4888:Kmt2a UTSW 9 44821680 unclassified probably benign
R4958:Kmt2a UTSW 9 44848467 missense probably damaging 1.00
R5055:Kmt2a UTSW 9 44818352 unclassified probably benign
R5065:Kmt2a UTSW 9 44842700 unclassified probably benign
R5185:Kmt2a UTSW 9 44820246 unclassified probably benign
R5358:Kmt2a UTSW 9 44819274 unclassified probably benign
R5411:Kmt2a UTSW 9 44848485 missense probably damaging 1.00
R5420:Kmt2a UTSW 9 44848336 missense probably damaging 1.00
R5483:Kmt2a UTSW 9 44824624 utr 3 prime probably benign
R5487:Kmt2a UTSW 9 44821975 unclassified probably benign
R5488:Kmt2a UTSW 9 44841038 utr 3 prime probably benign
R5489:Kmt2a UTSW 9 44841038 utr 3 prime probably benign
R5538:Kmt2a UTSW 9 44820342 unclassified probably benign
R5576:Kmt2a UTSW 9 44842634 missense possibly damaging 0.94
R5631:Kmt2a UTSW 9 44820688 unclassified probably benign
R5781:Kmt2a UTSW 9 44847842 nonsense probably null
R5789:Kmt2a UTSW 9 44819904 unclassified probably benign
R5932:Kmt2a UTSW 9 44820647 unclassified probably benign
R6027:Kmt2a UTSW 9 44819290 unclassified probably benign
R6191:Kmt2a UTSW 9 44826828 utr 3 prime probably benign
R6239:Kmt2a UTSW 9 44819796 unclassified probably benign
R6291:Kmt2a UTSW 9 44832874 utr 3 prime probably benign
R6344:Kmt2a UTSW 9 44821859 unclassified probably benign
R6611:Kmt2a UTSW 9 44849272 missense probably damaging 0.98
R6641:Kmt2a UTSW 9 44819835 unclassified probably benign
R6651:Kmt2a UTSW 9 44828811 nonsense probably null
R6825:Kmt2a UTSW 9 44818407 unclassified probably benign
R6853:Kmt2a UTSW 9 44818407 unclassified probably benign
R6897:Kmt2a UTSW 9 44847645 missense probably benign 0.03
R6930:Kmt2a UTSW 9 44842665 unclassified probably benign
R6932:Kmt2a UTSW 9 44829261 utr 3 prime probably benign
R6957:Kmt2a UTSW 9 44820022 unclassified probably benign
R7202:Kmt2a UTSW 9 44847715 missense probably benign 0.03
R7481:Kmt2a UTSW 9 44809071 missense unknown
R7538:Kmt2a UTSW 9 44847744 missense probably damaging 0.99
R7597:Kmt2a UTSW 9 44831353 missense unknown
X0021:Kmt2a UTSW 9 44831235 utr 3 prime probably benign
X0025:Kmt2a UTSW 9 44825392 nonsense probably null
X0026:Kmt2a UTSW 9 44820906 unclassified probably benign
X0027:Kmt2a UTSW 9 44880896 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGTTCCACATCACAGCCTAC -3'
(R):5'- GGTCCACCTAAGGCAAGTTC -3'

Sequencing Primer
(F):5'- TACCAGAAACAGCAGCAGTCTG -3'
(R):5'- AAGGCAAGTTCCATTTTGTCTGACG -3'
Posted On2019-06-26