Incidental Mutation 'R7170:Naca'
ID558204
Institutional Source Beutler Lab
Gene Symbol Naca
Ensembl Gene ENSMUSG00000061315
Gene Namenascent polypeptide-associated complex alpha polypeptide
SynonymsLOC380777, skNAC
MMRRC Submission
Accession Numbers

Genbank: NM_013608; MGI: 106095 ; Ensembl: ENSMUST00000092048

Is this an essential gene? Probably essential (E-score: 0.767) question?
Stock #R7170 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128035575-128048637 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128040121 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 341 (S341T)
Ref Sequence ENSEMBL: ENSMUSP00000089680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073868] [ENSMUST00000092048]
Predicted Effect probably benign
Transcript: ENSMUST00000073868
SMART Domains Protein: ENSMUSP00000073532
Gene: ENSMUSG00000061315

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Pfam:NAC 73 130 3.9e-27 PFAM
low complexity region 157 178 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000092048
AA Change: S341T
SMART Domains Protein: ENSMUSP00000089680
Gene: ENSMUSG00000061315
AA Change: S341T

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
low complexity region 105 117 N/A INTRINSIC
low complexity region 128 142 N/A INTRINSIC
low complexity region 516 533 N/A INTRINSIC
low complexity region 704 718 N/A INTRINSIC
low complexity region 937 954 N/A INTRINSIC
low complexity region 976 998 N/A INTRINSIC
low complexity region 1174 1195 N/A INTRINSIC
low complexity region 1349 1370 N/A INTRINSIC
low complexity region 1489 1504 N/A INTRINSIC
low complexity region 1572 1593 N/A INTRINSIC
low complexity region 1636 1670 N/A INTRINSIC
low complexity region 1714 1727 N/A INTRINSIC
low complexity region 1806 1827 N/A INTRINSIC
low complexity region 1889 1926 N/A INTRINSIC
low complexity region 1943 1957 N/A INTRINSIC
low complexity region 1972 1986 N/A INTRINSIC
low complexity region 2016 2029 N/A INTRINSIC
Pfam:NAC 2045 2101 1.7e-25 PFAM
low complexity region 2129 2150 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with basic transcription factor 3 (BTF3) to form the nascent polypeptide-associated complex (NAC). This complex binds to nascent proteins that lack a signal peptide motif as they emerge from the ribosome, blocking interaction with the signal recognition particle (SRP) and preventing mistranslocation to the endoplasmic reticulum. This protein is an IgE autoantigen in atopic dermatitis patients. Alternative splicing results in multiple transcript variants, but the full length nature of some of these variants, including those encoding very large proteins, has not been determined. There are multiple pseudogenes of this gene on different chromosomes. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a point mutation exhibit decreased bone volume and bone formation associated with accelerated mineralization and immature woven-bone formation. Mice null for the muscle specific isoform die during organogenesis with cardiac abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(156) : Targeted, other(1) Gene trapped(155)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik C A 9: 105,143,401 probably null Het
Abca8b T C 11: 109,945,828 T1214A probably benign Het
Adgrf5 G A 17: 43,446,138 V708M possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd7 T A 6: 18,868,390 Y170* probably null Het
Aplp2 T C 9: 31,170,443 D236G probably benign Het
Apoa5 T C 9: 46,270,139 M171T probably benign Het
Bcas3 T C 11: 85,495,918 V393A probably damaging Het
Ccdc47 T C 11: 106,202,478 N370S probably benign Het
Cfap77 A T 2: 28,985,842 Y85* probably null Het
Col4a3 G A 1: 82,715,909 probably null Het
Crnn T A 3: 93,148,713 S269T possibly damaging Het
Crocc2 G A 1: 93,193,982 A618T possibly damaging Het
D030056L22Rik A G 19: 18,713,373 K17R possibly damaging Het
Emx1 G A 6: 85,188,001 G20D probably benign Het
Fabp3 A G 4: 130,313,970 D88G probably benign Het
Fam124a A C 14: 62,587,180 D41A probably damaging Het
Fam198a G T 9: 121,978,235 A482S probably damaging Het
Fanca T C 8: 123,271,206 E1247G probably damaging Het
Fat3 T C 9: 16,006,574 R1518G probably damaging Het
Fgf12 T C 16: 28,445,179 I5V probably benign Het
Fscn2 C A 11: 120,362,509 N267K probably damaging Het
Fubp3 A G 2: 31,598,620 T163A probably benign Het
Gm498 T C 7: 143,896,365 S285P probably damaging Het
Gm813 G T 16: 58,615,728 C77* probably null Het
Gne A G 4: 44,040,361 L601P possibly damaging Het
Gphn T C 12: 78,683,889 V766A possibly damaging Het
Hsf1 G T 15: 76,500,021 G402C probably damaging Het
Ift81 A T 5: 122,555,533 Y604* probably null Het
Iqgap3 T A 3: 88,102,063 I768N probably damaging Het
Kazald1 A T 19: 45,078,416 D218V probably benign Het
Kmt2a T C 9: 44,810,721 N3776D unknown Het
Ktn1 T C 14: 47,706,410 L872S probably damaging Het
Lama3 T G 18: 12,404,076 F259L probably benign Het
Mfsd6 A G 1: 52,662,388 probably null Het
Mical3 A T 6: 120,973,733 probably null Het
Mob3b A G 4: 35,083,839 Y117H probably damaging Het
Mrpl2 G A 17: 46,648,255 G95D probably damaging Het
Mstn A T 1: 53,066,395 I299F probably damaging Het
Mta3 C T 17: 83,714,662 R49W probably damaging Het
Mylk3 A G 8: 85,350,485 F574L probably damaging Het
Ncoa1 T C 12: 4,249,722 D1401G probably benign Het
Nedd4 T A 9: 72,670,099 Y69N probably benign Het
Nin T C 12: 70,044,239 T801A Het
Nsd1 T A 13: 55,261,626 L1336* probably null Het
Olfr1138 C T 2: 87,737,712 G204D probably damaging Het
Olfr1257 A G 2: 89,880,841 N5S probably benign Het
Olfr1257 A T 2: 89,881,053 T76S possibly damaging Het
Oprk1 G A 1: 5,602,396 R252H probably damaging Het
Pcdhga11 T C 18: 37,756,664 F242L probably damaging Het
Pof1b A G X: 112,644,345 I544T probably benign Het
Pold1 T C 7: 44,542,148 H138R possibly damaging Het
Ptprd A T 4: 76,071,962 D504E probably benign Het
Rabgap1l A G 1: 160,645,365 V501A probably damaging Het
Rimklb T C 6: 122,452,738 N233S probably benign Het
Rnf213 A G 11: 119,452,575 I3589V Het
Rora T A 9: 69,373,190 C348* probably null Het
Sdhaf3 T C 6: 6,956,043 V6A probably benign Het
Serpina3m T A 12: 104,389,518 L148Q probably damaging Het
Sik1 T C 17: 31,848,772 D443G possibly damaging Het
Sim2 A G 16: 94,122,700 T366A probably benign Het
Slc32a1 T C 2: 158,611,323 F28L probably damaging Het
Sorbs1 A T 19: 40,326,129 Y746* probably null Het
Speer4b T A 5: 27,498,823 N106I possibly damaging Het
Sphkap A G 1: 83,265,985 S1269P probably damaging Het
Tcf4 T C 18: 69,633,578 V205A probably damaging Het
Thsd7a C T 6: 12,352,091 R1035H Het
Tmprss11c A T 5: 86,237,619 probably null Het
Trim50 A G 5: 135,367,511 T438A probably benign Het
Ttc21a C T 9: 119,945,541 P287L probably damaging Het
Ttc41 C T 10: 86,713,503 S187L probably benign Het
Ttll3 C T 6: 113,413,878 P807L probably benign Het
Ttn A C 2: 76,767,352 V19739G probably benign Het
Usp15 C A 10: 123,171,195 C127F probably damaging Het
Vmn2r100 G T 17: 19,531,971 A822S probably benign Het
Zan A T 5: 137,463,494 V1141D unknown Het
Zfp457 A T 13: 67,294,177 C111* probably null Het
Zfp758 C T 17: 22,375,135 Q201* probably null Het
Zkscan2 T C 7: 123,499,807 E54G possibly damaging Het
Other mutations in Naca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Naca APN 10 128041682 intron probably benign
IGL00990:Naca APN 10 128043800 intron probably benign
IGL01093:Naca APN 10 128048113 missense probably damaging 0.99
IGL01356:Naca APN 10 128041715 intron probably benign
IGL01548:Naca APN 10 128040904 intron probably benign
IGL02089:Naca APN 10 128036489 splice site probably benign
IGL02148:Naca APN 10 128043884 intron probably benign
IGL02494:Naca APN 10 128041310 intron probably benign
IGL02672:Naca APN 10 128040283 intron probably benign
IGL02822:Naca APN 10 128039345 intron probably benign
IGL02904:Naca APN 10 128043290 intron probably benign
IGL02931:Naca APN 10 128047682 missense probably damaging 1.00
IGL02971:Naca APN 10 128041568 intron probably benign
IGL03104:Naca APN 10 128040364 intron probably benign
Sinewy UTSW 10 128048358 missense probably damaging 1.00
D4216:Naca UTSW 10 128044240 missense possibly damaging 0.73
P0042:Naca UTSW 10 128041553 intron probably benign
R0110:Naca UTSW 10 128044790 missense probably benign 0.13
R0220:Naca UTSW 10 128043386 intron probably benign
R0469:Naca UTSW 10 128044790 missense probably benign 0.13
R0528:Naca UTSW 10 128043293 missense probably benign 0.23
R0594:Naca UTSW 10 128040355 intron probably benign
R0626:Naca UTSW 10 128041162 intron probably benign
R0885:Naca UTSW 10 128040179 nonsense probably null
R1129:Naca UTSW 10 128040202 intron probably benign
R1437:Naca UTSW 10 128042179 intron probably benign
R1464:Naca UTSW 10 128048288 missense probably damaging 0.96
R1464:Naca UTSW 10 128048288 missense probably damaging 0.96
R1509:Naca UTSW 10 128043397 intron probably benign
R1561:Naca UTSW 10 128040398 intron probably benign
R1574:Naca UTSW 10 128040398 intron probably benign
R1678:Naca UTSW 10 128043526 intron probably benign
R1901:Naca UTSW 10 128043721 intron probably benign
R2884:Naca UTSW 10 128041678 intron probably benign
R2886:Naca UTSW 10 128041678 intron probably benign
R3176:Naca UTSW 10 128040661 intron probably benign
R3276:Naca UTSW 10 128040661 intron probably benign
R4227:Naca UTSW 10 128041661 intron probably benign
R4388:Naca UTSW 10 128044792 missense probably damaging 0.99
R4402:Naca UTSW 10 128043472 intron probably benign
R4798:Naca UTSW 10 128047803 missense probably null 0.99
R4955:Naca UTSW 10 128042215 intron probably benign
R4996:Naca UTSW 10 128042429 intron probably benign
R5027:Naca UTSW 10 128048121 missense possibly damaging 0.63
R5580:Naca UTSW 10 128040593 intron probably benign
R5752:Naca UTSW 10 128041928 intron probably benign
R5788:Naca UTSW 10 128040142 intron probably benign
R6156:Naca UTSW 10 128039291 intron probably benign
R6227:Naca UTSW 10 128043916 intron probably benign
R6317:Naca UTSW 10 128044124 missense probably benign 0.33
R6665:Naca UTSW 10 128048358 missense probably damaging 1.00
R7247:Naca UTSW 10 128042598 missense unknown
R7632:Naca UTSW 10 128040506 missense unknown
X0053:Naca UTSW 10 128048255 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGCATCACAGTTCTGTGGATTC -3'
(R):5'- CAGAAGGGTTATCCAGGGCATG -3'

Sequencing Primer
(F):5'- ACAGTTCTGTGGATTCTCCCATC -3'
(R):5'- CATGGTGGGTGGCTCCAATAC -3'
Posted On2019-06-26