Incidental Mutation 'R7170:Sim2'
ID558221
Institutional Source Beutler Lab
Gene Symbol Sim2
Ensembl Gene ENSMUSG00000062713
Gene Namesingle-minded family bHLH transcription factor 2
SynonymsbHLHe15
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7170 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location94084931-94127032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94122700 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 366 (T366A)
Ref Sequence ENSEMBL: ENSMUSP00000072043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072182] [ENSMUST00000231688]
Predicted Effect probably benign
Transcript: ENSMUST00000072182
AA Change: T366A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000072043
Gene: ENSMUSG00000062713
AA Change: T366A

DomainStartEndE-ValueType
HLH 6 58 6.99e-5 SMART
PAS 79 145 7.8e-13 SMART
PAS 220 286 1.31e-5 SMART
PAC 292 335 2.44e-5 SMART
Pfam:SIM_C 358 650 4.5e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231688
AA Change: T366A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a homolog of the Drosophila single-minded (sim) gene, which encodes a transcription factor that is a master regulator of neurogenesis. The encoded protein is ubiquitinated by RING-IBR-RING-type E3 ubiquitin ligases, including the parkin RBR E3 ubiquitin protein ligase. This gene maps within the so-called Down syndrome chromosomal region, and is thus thought to contribute to some specific Down syndrome phenotypes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous mutation of this gene results in postnatal lethality, cleft palate, malformed pterygoid processes, and aerophagia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik C A 9: 105,143,401 probably null Het
Abca8b T C 11: 109,945,828 T1214A probably benign Het
Adgrf5 G A 17: 43,446,138 V708M possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd7 T A 6: 18,868,390 Y170* probably null Het
Aplp2 T C 9: 31,170,443 D236G probably benign Het
Apoa5 T C 9: 46,270,139 M171T probably benign Het
Bcas3 T C 11: 85,495,918 V393A probably damaging Het
Ccdc47 T C 11: 106,202,478 N370S probably benign Het
Cfap77 A T 2: 28,985,842 Y85* probably null Het
Col4a3 G A 1: 82,715,909 probably null Het
Crnn T A 3: 93,148,713 S269T possibly damaging Het
Crocc2 G A 1: 93,193,982 A618T possibly damaging Het
D030056L22Rik A G 19: 18,713,373 K17R possibly damaging Het
Emx1 G A 6: 85,188,001 G20D probably benign Het
Fabp3 A G 4: 130,313,970 D88G probably benign Het
Fam124a A C 14: 62,587,180 D41A probably damaging Het
Fam198a G T 9: 121,978,235 A482S probably damaging Het
Fanca T C 8: 123,271,206 E1247G probably damaging Het
Fat3 T C 9: 16,006,574 R1518G probably damaging Het
Fgf12 T C 16: 28,445,179 I5V probably benign Het
Fscn2 C A 11: 120,362,509 N267K probably damaging Het
Fubp3 A G 2: 31,598,620 T163A probably benign Het
Gm498 T C 7: 143,896,365 S285P probably damaging Het
Gm813 G T 16: 58,615,728 C77* probably null Het
Gne A G 4: 44,040,361 L601P possibly damaging Het
Gphn T C 12: 78,683,889 V766A possibly damaging Het
Hsf1 G T 15: 76,500,021 G402C probably damaging Het
Ift81 A T 5: 122,555,533 Y604* probably null Het
Iqgap3 T A 3: 88,102,063 I768N probably damaging Het
Kazald1 A T 19: 45,078,416 D218V probably benign Het
Kmt2a T C 9: 44,810,721 N3776D unknown Het
Ktn1 T C 14: 47,706,410 L872S probably damaging Het
Lama3 T G 18: 12,404,076 F259L probably benign Het
Mfsd6 A G 1: 52,662,388 probably null Het
Mical3 A T 6: 120,973,733 probably null Het
Mob3b A G 4: 35,083,839 Y117H probably damaging Het
Mrpl2 G A 17: 46,648,255 G95D probably damaging Het
Mstn A T 1: 53,066,395 I299F probably damaging Het
Mta3 C T 17: 83,714,662 R49W probably damaging Het
Mylk3 A G 8: 85,350,485 F574L probably damaging Het
Naca T A 10: 128,040,121 S341T unknown Het
Ncoa1 T C 12: 4,249,722 D1401G probably benign Het
Nedd4 T A 9: 72,670,099 Y69N probably benign Het
Nin T C 12: 70,044,239 T801A Het
Nsd1 T A 13: 55,261,626 L1336* probably null Het
Olfr1138 C T 2: 87,737,712 G204D probably damaging Het
Olfr1257 A G 2: 89,880,841 N5S probably benign Het
Olfr1257 A T 2: 89,881,053 T76S possibly damaging Het
Oprk1 G A 1: 5,602,396 R252H probably damaging Het
Pcdhga11 T C 18: 37,756,664 F242L probably damaging Het
Pof1b A G X: 112,644,345 I544T probably benign Het
Pold1 T C 7: 44,542,148 H138R possibly damaging Het
Ptprd A T 4: 76,071,962 D504E probably benign Het
Rabgap1l A G 1: 160,645,365 V501A probably damaging Het
Rimklb T C 6: 122,452,738 N233S probably benign Het
Rnf213 A G 11: 119,452,575 I3589V Het
Rora T A 9: 69,373,190 C348* probably null Het
Sdhaf3 T C 6: 6,956,043 V6A probably benign Het
Serpina3m T A 12: 104,389,518 L148Q probably damaging Het
Sik1 T C 17: 31,848,772 D443G possibly damaging Het
Slc32a1 T C 2: 158,611,323 F28L probably damaging Het
Sorbs1 A T 19: 40,326,129 Y746* probably null Het
Speer4b T A 5: 27,498,823 N106I possibly damaging Het
Sphkap A G 1: 83,265,985 S1269P probably damaging Het
Tcf4 T C 18: 69,633,578 V205A probably damaging Het
Thsd7a C T 6: 12,352,091 R1035H Het
Tmprss11c A T 5: 86,237,619 probably null Het
Trim50 A G 5: 135,367,511 T438A probably benign Het
Ttc21a C T 9: 119,945,541 P287L probably damaging Het
Ttc41 C T 10: 86,713,503 S187L probably benign Het
Ttll3 C T 6: 113,413,878 P807L probably benign Het
Ttn A C 2: 76,767,352 V19739G probably benign Het
Usp15 C A 10: 123,171,195 C127F probably damaging Het
Vmn2r100 G T 17: 19,531,971 A822S probably benign Het
Zan A T 5: 137,463,494 V1141D unknown Het
Zfp457 A T 13: 67,294,177 C111* probably null Het
Zfp758 C T 17: 22,375,135 Q201* probably null Het
Zkscan2 T C 7: 123,499,807 E54G possibly damaging Het
Other mutations in Sim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Sim2 APN 16 94114944 nonsense probably null
IGL01329:Sim2 APN 16 94106260 missense possibly damaging 0.64
IGL01965:Sim2 APN 16 94121178 missense probably benign 0.20
IGL01979:Sim2 APN 16 94123482 missense possibly damaging 0.81
IGL02821:Sim2 APN 16 94097188 missense probably damaging 1.00
IGL03027:Sim2 APN 16 94109492 splice site probably benign
P0027:Sim2 UTSW 16 94109422 missense probably benign 0.02
PIT4696001:Sim2 UTSW 16 94094309 missense possibly damaging 0.49
R1836:Sim2 UTSW 16 94123577 critical splice donor site probably null
R2034:Sim2 UTSW 16 94085942 missense probably damaging 0.96
R4085:Sim2 UTSW 16 94109354 missense possibly damaging 0.48
R4475:Sim2 UTSW 16 94125791 missense probably benign
R4476:Sim2 UTSW 16 94125791 missense probably benign
R4647:Sim2 UTSW 16 94123526 missense possibly damaging 0.71
R4919:Sim2 UTSW 16 94109335 missense probably benign 0.01
R4966:Sim2 UTSW 16 94123421 missense probably benign 0.03
R5320:Sim2 UTSW 16 94104739 missense probably benign 0.01
R5555:Sim2 UTSW 16 94109456 missense probably damaging 1.00
R5591:Sim2 UTSW 16 94097189 missense probably damaging 1.00
R5870:Sim2 UTSW 16 94123334 missense probably damaging 0.99
R6020:Sim2 UTSW 16 94097251 missense probably damaging 1.00
R6302:Sim2 UTSW 16 94097230 missense probably damaging 1.00
R6883:Sim2 UTSW 16 94125536 missense probably benign 0.00
R7559:Sim2 UTSW 16 94109359 missense possibly damaging 0.95
R7740:Sim2 UTSW 16 94114960 missense probably benign 0.25
T0722:Sim2 UTSW 16 94109422 missense probably benign 0.02
X0063:Sim2 UTSW 16 94122698 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AAGAGATGCTCTGGGACTGG -3'
(R):5'- ATATGCTTATCCTCCGAGCTGTTTG -3'

Sequencing Primer
(F):5'- CTGGAGGAGAAGCTTGCTC -3'
(R):5'- CCGAGCTGTTTGTGGGACC -3'
Posted On2019-06-26