Incidental Mutation 'R7170:Pof1b'
ID558234
Institutional Source Beutler Lab
Gene Symbol Pof1b
Ensembl Gene ENSMUSG00000034607
Gene Namepremature ovarian failure 1B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7170 (G1)
Quality Score221.999
Status Validated
ChromosomeX
Chromosomal Location112638431-112698651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112644345 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 544 (I544T)
Ref Sequence ENSEMBL: ENSMUSP00000047655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039887]
Predicted Effect probably benign
Transcript: ENSMUST00000039887
AA Change: I544T

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000047655
Gene: ENSMUSG00000034607
AA Change: I544T

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 25 44 N/A INTRINSIC
low complexity region 183 217 N/A INTRINSIC
coiled coil region 331 441 N/A INTRINSIC
coiled coil region 463 529 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Premature ovarian failure (POF) is characterized by primary or secondary amenorrhea in women less than 40 years old. Two POF susceptibility regions called "POF1" and "POF2" have been identified by breakpoint mapping of X-autosome translocations. POF1 extends from Xq21-qter while POF2 extends from Xq13.3 to Xq21.1. This gene, POF1B, resides in the POF2 region. This gene is expressed at trace levels in mouse prenatal ovary and is barely detectable or absent from adult ovary, in human and in the mouse respectively. This gene's expression is restricted to epithelia with its highest expression in the epidermis, and oro-pharyngeal and gastro-intestinal tracts. The protein encoded by this gene binds non-muscle actin filaments. The role this gene may play in the etiology of premature ovarian failure remains to be determined. [provided by RefSeq, Jan 2010]
PHENOTYPE: Both male and female mice homozygous for a targeted knockout mutation of this gene are viable and fertile have no reported abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik C A 9: 105,143,401 probably null Het
Abca8b T C 11: 109,945,828 T1214A probably benign Het
Adgrf5 G A 17: 43,446,138 V708M possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd7 T A 6: 18,868,390 Y170* probably null Het
Aplp2 T C 9: 31,170,443 D236G probably benign Het
Apoa5 T C 9: 46,270,139 M171T probably benign Het
Bcas3 T C 11: 85,495,918 V393A probably damaging Het
Ccdc47 T C 11: 106,202,478 N370S probably benign Het
Cfap77 A T 2: 28,985,842 Y85* probably null Het
Col4a3 G A 1: 82,715,909 probably null Het
Crnn T A 3: 93,148,713 S269T possibly damaging Het
Crocc2 G A 1: 93,193,982 A618T possibly damaging Het
D030056L22Rik A G 19: 18,713,373 K17R possibly damaging Het
Emx1 G A 6: 85,188,001 G20D probably benign Het
Fabp3 A G 4: 130,313,970 D88G probably benign Het
Fam124a A C 14: 62,587,180 D41A probably damaging Het
Fam198a G T 9: 121,978,235 A482S probably damaging Het
Fanca T C 8: 123,271,206 E1247G probably damaging Het
Fat3 T C 9: 16,006,574 R1518G probably damaging Het
Fgf12 T C 16: 28,445,179 I5V probably benign Het
Fscn2 C A 11: 120,362,509 N267K probably damaging Het
Fubp3 A G 2: 31,598,620 T163A probably benign Het
Gm498 T C 7: 143,896,365 S285P probably damaging Het
Gm813 G T 16: 58,615,728 C77* probably null Het
Gne A G 4: 44,040,361 L601P possibly damaging Het
Gphn T C 12: 78,683,889 V766A possibly damaging Het
Hsf1 G T 15: 76,500,021 G402C probably damaging Het
Ift81 A T 5: 122,555,533 Y604* probably null Het
Iqgap3 T A 3: 88,102,063 I768N probably damaging Het
Kazald1 A T 19: 45,078,416 D218V probably benign Het
Kmt2a T C 9: 44,810,721 N3776D unknown Het
Ktn1 T C 14: 47,706,410 L872S probably damaging Het
Lama3 T G 18: 12,404,076 F259L probably benign Het
Mfsd6 A G 1: 52,662,388 probably null Het
Mical3 A T 6: 120,973,733 probably null Het
Mob3b A G 4: 35,083,839 Y117H probably damaging Het
Mrpl2 G A 17: 46,648,255 G95D probably damaging Het
Mstn A T 1: 53,066,395 I299F probably damaging Het
Mta3 C T 17: 83,714,662 R49W probably damaging Het
Mylk3 A G 8: 85,350,485 F574L probably damaging Het
Naca T A 10: 128,040,121 S341T unknown Het
Ncoa1 T C 12: 4,249,722 D1401G probably benign Het
Nedd4 T A 9: 72,670,099 Y69N probably benign Het
Nin T C 12: 70,044,239 T801A Het
Nsd1 T A 13: 55,261,626 L1336* probably null Het
Olfr1138 C T 2: 87,737,712 G204D probably damaging Het
Olfr1257 A G 2: 89,880,841 N5S probably benign Het
Olfr1257 A T 2: 89,881,053 T76S possibly damaging Het
Oprk1 G A 1: 5,602,396 R252H probably damaging Het
Pcdhga11 T C 18: 37,756,664 F242L probably damaging Het
Pold1 T C 7: 44,542,148 H138R possibly damaging Het
Ptprd A T 4: 76,071,962 D504E probably benign Het
Rabgap1l A G 1: 160,645,365 V501A probably damaging Het
Rimklb T C 6: 122,452,738 N233S probably benign Het
Rnf213 A G 11: 119,452,575 I3589V Het
Rora T A 9: 69,373,190 C348* probably null Het
Sdhaf3 T C 6: 6,956,043 V6A probably benign Het
Serpina3m T A 12: 104,389,518 L148Q probably damaging Het
Sik1 T C 17: 31,848,772 D443G possibly damaging Het
Sim2 A G 16: 94,122,700 T366A probably benign Het
Slc32a1 T C 2: 158,611,323 F28L probably damaging Het
Sorbs1 A T 19: 40,326,129 Y746* probably null Het
Speer4b T A 5: 27,498,823 N106I possibly damaging Het
Sphkap A G 1: 83,265,985 S1269P probably damaging Het
Tcf4 T C 18: 69,633,578 V205A probably damaging Het
Thsd7a C T 6: 12,352,091 R1035H Het
Tmprss11c A T 5: 86,237,619 probably null Het
Trim50 A G 5: 135,367,511 T438A probably benign Het
Ttc21a C T 9: 119,945,541 P287L probably damaging Het
Ttc41 C T 10: 86,713,503 S187L probably benign Het
Ttll3 C T 6: 113,413,878 P807L probably benign Het
Ttn A C 2: 76,767,352 V19739G probably benign Het
Usp15 C A 10: 123,171,195 C127F probably damaging Het
Vmn2r100 G T 17: 19,531,971 A822S probably benign Het
Zan A T 5: 137,463,494 V1141D unknown Het
Zfp457 A T 13: 67,294,177 C111* probably null Het
Zfp758 C T 17: 22,375,135 Q201* probably null Het
Zkscan2 T C 7: 123,499,807 E54G possibly damaging Het
Other mutations in Pof1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02629:Pof1b APN X 112645237 splice site probably benign
IGL02902:Pof1b APN X 112649112 critical splice acceptor site probably null
IGL03231:Pof1b APN X 112645290 missense possibly damaging 0.52
IGL03246:Pof1b APN X 112648120 missense probably benign
R7169:Pof1b UTSW X 112644345 missense probably benign 0.14
R7171:Pof1b UTSW X 112644345 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CTGATGGCCCCAATGTCATAAAC -3'
(R):5'- GCCTGTATAGCATTTTGACTACTG -3'

Sequencing Primer
(F):5'- TGGCCCCAATGTCATAAACAACTTTG -3'
(R):5'- AGCATTTTGACTACTGTGTATCAAC -3'
Posted On2019-06-26