Incidental Mutation 'R0587:Ctsf'

• ID: 55826
• Institutional Source: Beutler Lab
• Gene Symbol: Ctsf
• Ensembl Gene: ENSMUSG00000083282
• Gene Name: cathepsin F
• MMRRC Submission: 038777-MU
• Is this an essential gene?: Probably non essential (E-score: 0.118)
• Stock #: R0587 (G1)
• Quality Score: 185
• Status: Validated
• Chromosome: 19
• Chromosomal Location: 4855129-4860912 bp(+) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): A to G at 4855738 bp
• Zygosity: Heterozygous
• Amino Acid Change: Glutamic Acid to Glycine at position 87 (E87G)
• Ref Sequence: ENSEMBL: ENSMUSP00000112481
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000119694]
• Predicted Effect: probably benign; Transcript: ENSMUST00000119694; AA Change: E87G; PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
• SMART Domains: Protein: ENSMUSP00000112481; Gene: ENSMUSG00000083282; AA Change: E87G

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	55	77	N/A	INTRINSIC
low complexity region	111	122	N/A	INTRINSIC
low complexity region	145	156	N/A	INTRINSIC
Inhibitor_I29	165	222	5.41e-16	SMART
Pept_C1	249	460	4.2e-93	SMART

• Meta Mutation Damage Score: 0.0674
• Coding Region Coverage:
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
• Validation Efficiency: 94% (34/36)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cathepsins are papain family cysteine proteinases that represent a major component of the lysosomal proteolytic system. Cathepsins generally contain a signal sequence, followed by a propeptide and then a catalytically active mature region. The very long (251 amino acid residues) proregion of the cathepsin F precursor contains a C-terminal domain similar to the pro-segment of cathepsin L-like enzymes, a 50-residue flexible linker peptide, and an N-terminal domain predicted to adopt a cystatin-like fold. The cathepsin F proregion is unique within the papain family cysteine proteases in that it contains this additional N-terminal segment predicted to share structural similarities with cysteine protease inhibitors of the cystatin superfamily. This cystatin-like domain contains some of the elements known to be important for inhibitory activity. CTSF encodes a predicted protein of 484 amino acids which contains a 19 residue signal peptide. Cathepsin F contains five potential N-glycosylation sites, and it may be targeted to the endosomal/lysosomal compartment via the mannose 6-phosphate receptor pathway. The cathepsin F gene is ubiquitously expressed, and it maps to chromosome 11q13, close to the gene encoding cathepsin W. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a knock-out allele develop neuronal lipofuscinosis and late-onset neurological disease characterized by reduced brain mass, progressive hind leg weakness, impaired motor coordination, tremors, severe gliosis, general wasting, and premature death. [provided by MGI curators]
• Posted On: 2013-07-11

Predicted Primers

PCR Primer
(F):5'- CGCGCTGGACATGTACAATTACGG -3'
(R):5'- AGCCACATGGAAGGCAGTCATAAC -3'

Sequencing Primer
(F):5'- ACAAGGGCCGTGCTAGG -3'
(R):5'- TGGAAGGCAGTCATAACTTGGTG -3'