Incidental Mutation 'R7171:Faap24'
ID558267
Institutional Source Beutler Lab
Gene Symbol Faap24
Ensembl Gene ENSMUSG00000030493
Gene NameFanconi anemia core complex associated protein 24
SynonymsC230052I12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R7171 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location35392152-35396836 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 35392854 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 213 (Q213*)
Ref Sequence ENSEMBL: ENSMUSP00000032704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032704] [ENSMUST00000032705] [ENSMUST00000079414] [ENSMUST00000085556] [ENSMUST00000141704] [ENSMUST00000154597] [ENSMUST00000206854]
Predicted Effect probably null
Transcript: ENSMUST00000032704
AA Change: Q213*
SMART Domains Protein: ENSMUSP00000032704
Gene: ENSMUSG00000030493
AA Change: Q213*

DomainStartEndE-ValueType
Pfam:HHH_2 162 219 1.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032705
SMART Domains Protein: ENSMUSP00000032705
Gene: ENSMUSG00000030494

DomainStartEndE-ValueType
Hr1 38 101 2.42e-12 SMART
BRO1 111 513 1.27e-167 SMART
PDZ 524 594 1.73e-9 SMART
low complexity region 623 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079414
SMART Domains Protein: ENSMUSP00000078383
Gene: ENSMUSG00000023072

DomainStartEndE-ValueType
low complexity region 27 62 N/A INTRINSIC
low complexity region 181 190 N/A INTRINSIC
coiled coil region 252 291 N/A INTRINSIC
coiled coil region 372 598 N/A INTRINSIC
coiled coil region 670 732 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085556
SMART Domains Protein: ENSMUSP00000082692
Gene: ENSMUSG00000030494

DomainStartEndE-ValueType
Hr1 38 101 2.42e-12 SMART
BRO1 111 513 1.27e-167 SMART
PDZ 524 594 1.73e-9 SMART
low complexity region 623 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141704
SMART Domains Protein: ENSMUSP00000121393
Gene: ENSMUSG00000023072

DomainStartEndE-ValueType
low complexity region 27 62 N/A INTRINSIC
low complexity region 181 190 N/A INTRINSIC
coiled coil region 252 291 N/A INTRINSIC
coiled coil region 372 598 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000154597
AA Change: Q213*
SMART Domains Protein: ENSMUSP00000115766
Gene: ENSMUSG00000030493
AA Change: Q213*

DomainStartEndE-ValueType
Pfam:HHH_2 162 219 2.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206854
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FAAP24 is a component of the Fanconi anemia (FA) core complex (see MIM 227650), which plays a crucial role in DNA damage response (Ciccia et al., 2007 [PubMed 17289582]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519P11Rik T C 2: 154,612,977 N154S unknown Het
9530053A07Rik T A 7: 28,154,519 L1636* probably null Het
Ank3 C T 10: 69,992,481 H2327Y Het
Ano6 A G 15: 95,920,291 Y305C probably damaging Het
Apc2 A G 10: 80,315,336 T2075A possibly damaging Het
Arl6 A G 16: 59,623,092 V93A possibly damaging Het
Bcas3 T C 11: 85,583,937 S790P probably damaging Het
Bcl9l C A 9: 44,505,151 H211N probably benign Het
Bptf G T 11: 107,131,407 D172E unknown Het
Card9 T G 2: 26,359,484 I22L possibly damaging Het
Catsperg1 C A 7: 29,185,212 G933V probably damaging Het
Catsperg2 T A 7: 29,705,325 H771L possibly damaging Het
Ccdc66 T C 14: 27,493,272 N281S possibly damaging Het
Cfap54 A T 10: 92,776,210 L3162H probably damaging Het
Clca4a A G 3: 144,958,173 L503P probably benign Het
Cpn1 T C 19: 43,974,031 N160D probably damaging Het
Ctsh T A 9: 90,067,101 I206K probably benign Het
Cyb561d1 G A 3: 108,199,363 T180M probably damaging Het
Dapk1 A T 13: 60,761,785 D1404V probably damaging Het
Dip2c G T 13: 9,506,648 R76L probably benign Het
Dnah7c T C 1: 46,680,738 I2783T probably damaging Het
E130308A19Rik T C 4: 59,690,333 Y56H probably damaging Het
Efemp2 G T 19: 5,480,257 A310S probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam181b G A 7: 93,080,735 G239S possibly damaging Het
Fancm T C 12: 65,101,620 W670R probably damaging Het
Fmnl1 T C 11: 103,190,398 Y357H probably damaging Het
Fryl A T 5: 73,122,310 V215E probably damaging Het
Fscn2 C A 11: 120,362,509 N267K probably damaging Het
Fsip2 T A 2: 82,986,227 Y4101* probably null Het
Gcn1l1 G A 5: 115,590,293 V738I probably benign Het
Gdf9 C T 11: 53,437,539 R441C probably damaging Het
Gipc3 C T 10: 81,341,621 G79E probably damaging Het
Gzmf T A 14: 56,205,934 I196L probably benign Het
Hectd1 A T 12: 51,759,297 V1852E probably damaging Het
Hip1r A T 5: 123,995,944 Q256L probably benign Het
Hmgxb4 T C 8: 75,020,262 S405P probably damaging Het
Il9r T A 11: 32,192,671 H294L probably benign Het
Kif12 G A 4: 63,168,694 T331I probably damaging Het
Krtap8-1 A T 16: 89,487,906 M1K probably null Het
Lamc2 A T 1: 153,139,749 C613S probably damaging Het
Lgr4 T A 2: 110,000,969 N314K probably benign Het
Lpcat2 T C 8: 92,909,266 I432T probably benign Het
Mfhas1 T C 8: 35,588,992 V207A probably benign Het
Msh3 T G 13: 92,349,298 T173P probably benign Het
Mup15 T A 4: 61,438,268 M87L probably benign Het
N4bp2 T C 5: 65,808,022 V1138A probably benign Het
Noc2l T C 4: 156,241,722 V422A probably benign Het
Notch3 C T 17: 32,158,962 G74D probably damaging Het
Ocstamp T A 2: 165,398,161 K35I probably benign Het
Olfr360 T C 2: 37,068,388 F28L possibly damaging Het
Olfr459 T G 6: 41,772,027 T91P probably benign Het
Olfr482 A G 7: 108,095,135 V145A probably benign Het
Olfr692 A G 7: 105,368,761 H145R probably benign Het
Plekhh2 T A 17: 84,521,788 V29D probably damaging Het
Pof1b A G X: 112,644,345 I544T probably benign Het
Rad54l2 C T 9: 106,713,478 R483H probably damaging Het
Rapgef6 T A 11: 54,676,363 D1128E possibly damaging Het
Rhbdl2 T A 4: 123,814,256 I86N possibly damaging Het
Rims1 C A 1: 22,428,489 R68L Het
Rnf157 A G 11: 116,362,373 F70L possibly damaging Het
Rtp3 C T 9: 110,985,941 C452Y unknown Het
S100a14 A T 3: 90,527,762 K27* probably null Het
Scai C T 2: 39,106,936 G282D possibly damaging Het
Sclt1 A T 3: 41,717,760 I132N probably benign Het
Serpinf1 T A 11: 75,417,985 Q2L possibly damaging Het
Skor2 T A 18: 76,860,986 V801E probably benign Het
Slc16a10 C G 10: 40,037,259 E484D probably benign Het
Slc1a5 T A 7: 16,797,538 D489E probably damaging Het
Slx4 C T 16: 3,990,786 R430H probably benign Het
Teddm1b A T 1: 153,874,933 I163F probably damaging Het
Tmem171 A T 13: 98,692,236 C135* probably null Het
Tmem82 C T 4: 141,614,973 R306H possibly damaging Het
Tmem94 T A 11: 115,790,955 probably null Het
Trpm2 A C 10: 77,924,014 L1096R probably damaging Het
Trrap T A 5: 144,794,049 L780Q probably damaging Het
Txlnb A G 10: 17,842,984 D521G probably benign Het
Usp7 T C 16: 8,716,526 D59G probably benign Het
Vcan G A 13: 89,725,591 T48I probably damaging Het
Vmn1r45 A G 6: 89,933,334 L218P probably damaging Het
Wdr25 A T 12: 109,024,996 T370S probably damaging Het
Other mutations in Faap24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02265:Faap24 APN 7 35396264 missense probably benign 0.01
IGL02951:Faap24 APN 7 35392951 missense probably damaging 0.98
IGL03351:Faap24 APN 7 35395309 nonsense probably null
R0030:Faap24 UTSW 7 35392860 missense probably damaging 0.97
R0606:Faap24 UTSW 7 35394963 unclassified probably benign
R1378:Faap24 UTSW 7 35392901 missense probably benign 0.06
R3749:Faap24 UTSW 7 35393012 missense possibly damaging 0.94
R4661:Faap24 UTSW 7 35395084 missense probably benign 0.00
R6279:Faap24 UTSW 7 35396284 missense possibly damaging 0.90
R7025:Faap24 UTSW 7 35392871 missense possibly damaging 0.84
R7074:Faap24 UTSW 7 35395102 missense possibly damaging 0.92
R7249:Faap24 UTSW 7 35395060 missense probably benign
R7566:Faap24 UTSW 7 35393040 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCATCTTAGCAGAAAGTGGCCAG -3'
(R):5'- AGCTCTCCCTTGTTCAAACAG -3'

Sequencing Primer
(F):5'- CCAAGCCCCACCAGGTG -3'
(R):5'- CTTGTTCAAACAGTGCAGCAG -3'
Posted On2019-06-26