Mutagenetix > Incidental Mutation

Incidental Mutation 'R7171:Trpm2'

558281

Institutional Source

Beutler Lab

Gene Symbol

Trpm2

Ensembl Gene

ENSMUSG00000009292

Gene Name

transient receptor potential cation channel, subfamily M, member 2

Synonyms

LTRPC2, 9830168K16Rik, TRPC7, Trrp7

MMRRC Submission

045230-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R7171 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77907722-77970563 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 77924014 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 1096 (L1096R)

Ref Sequence

ENSEMBL: ENSMUSP00000101040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105401]

AlphaFold

Q91YD4

Predicted Effect

probably damaging
Transcript: ENSMUST00000105401
AA Change: L1096R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: L1096R

Domain	Start	End	E-Value	Type
low complexity region	654	672	N/A	INTRINSIC
transmembrane domain	750	772	N/A	INTRINSIC
Pfam:Ion_trans	794	1057	3.7e-21	PFAM
low complexity region	1078	1090	N/A	INTRINSIC
low complexity region	1106	1115	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC
PDB:1QVJ\|A	1236	1506	3e-37	PDB
SCOP:d1k2ea_	1369	1502	9e-10	SMART

Meta Mutation Damage Score

0.2202

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (81/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930519P11Rik	T	C	2: 154,612,977	N154S	unknown	Het
9530053A07Rik	T	A	7: 28,154,519	L1636*	probably null	Het
Ank3	C	T	10: 69,992,481	H2327Y		Het
Ano6	A	G	15: 95,920,291	Y305C	probably damaging	Het
Apc2	A	G	10: 80,315,336	T2075A	possibly damaging	Het
Arl6	A	G	16: 59,623,092	V93A	possibly damaging	Het
Bcas3	T	C	11: 85,583,937	S790P	probably damaging	Het
Bcl9l	C	A	9: 44,505,151	H211N	probably benign	Het
Bptf	G	T	11: 107,131,407	D172E	unknown	Het
Card9	T	G	2: 26,359,484	I22L	possibly damaging	Het
Catsperg1	C	A	7: 29,185,212	G933V	probably damaging	Het
Catsperg2	T	A	7: 29,705,325	H771L	possibly damaging	Het
Ccdc66	T	C	14: 27,493,272	N281S	possibly damaging	Het
Cfap54	A	T	10: 92,776,210	L3162H	probably damaging	Het
Clca4a	A	G	3: 144,958,173	L503P	probably benign	Het
Cpn1	T	C	19: 43,974,031	N160D	probably damaging	Het
Ctsh	T	A	9: 90,067,101	I206K	probably benign	Het
Cyb561d1	G	A	3: 108,199,363	T180M	probably damaging	Het
Dapk1	A	T	13: 60,761,785	D1404V	probably damaging	Het
Dip2c	G	T	13: 9,506,648	R76L	probably benign	Het
Dnah7c	T	C	1: 46,680,738	I2783T	probably damaging	Het
E130308A19Rik	T	C	4: 59,690,333	Y56H	probably damaging	Het
Efemp2	G	T	19: 5,480,257	A310S	probably benign	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Faap24	G	A	7: 35,392,854	Q213*	probably null	Het
Fam181b	G	A	7: 93,080,735	G239S	possibly damaging	Het
Fancm	T	C	12: 65,101,620	W670R	probably damaging	Het
Fmnl1	T	C	11: 103,190,398	Y357H	probably damaging	Het
Fryl	A	T	5: 73,122,310	V215E	probably damaging	Het
Fscn2	C	A	11: 120,362,509	N267K	probably damaging	Het
Fsip2	T	A	2: 82,986,227	Y4101*	probably null	Het
Gcn1l1	G	A	5: 115,590,293	V738I	probably benign	Het
Gdf9	C	T	11: 53,437,539	R441C	probably damaging	Het
Gipc3	C	T	10: 81,341,621	G79E	probably damaging	Het
Gzmf	T	A	14: 56,205,934	I196L	probably benign	Het
Hectd1	A	T	12: 51,759,297	V1852E	probably damaging	Het
Hip1r	A	T	5: 123,995,944	Q256L	probably benign	Het
Hmgxb4	T	C	8: 75,020,262	S405P	probably damaging	Het
Il9r	T	A	11: 32,192,671	H294L	probably benign	Het
Kif12	G	A	4: 63,168,694	T331I	probably damaging	Het
Krtap8-1	A	T	16: 89,487,906	M1K	probably null	Het
Lamc2	A	T	1: 153,139,749	C613S	probably damaging	Het
Lgr4	T	A	2: 110,000,969	N314K	probably benign	Het
Lpcat2	T	C	8: 92,909,266	I432T	probably benign	Het
Mfhas1	T	C	8: 35,588,992	V207A	probably benign	Het
Msh3	T	G	13: 92,349,298	T173P	probably benign	Het
Mup15	T	A	4: 61,438,268	M87L	probably benign	Het
N4bp2	T	C	5: 65,808,022	V1138A	probably benign	Het
Noc2l	T	C	4: 156,241,722	V422A	probably benign	Het
Notch3	C	T	17: 32,158,962	G74D	probably damaging	Het
Ocstamp	T	A	2: 165,398,161	K35I	probably benign	Het
Olfr360	T	C	2: 37,068,388	F28L	possibly damaging	Het
Olfr459	T	G	6: 41,772,027	T91P	probably benign	Het
Olfr482	A	G	7: 108,095,135	V145A	probably benign	Het
Olfr692	A	G	7: 105,368,761	H145R	probably benign	Het
Plekhh2	T	A	17: 84,521,788	V29D	probably damaging	Het
Pof1b	A	G	X: 112,644,345	I544T	probably benign	Het
Rad54l2	C	T	9: 106,713,478	R483H	probably damaging	Het
Rapgef6	T	A	11: 54,676,363	D1128E	possibly damaging	Het
Rhbdl2	T	A	4: 123,814,256	I86N	possibly damaging	Het
Rims1	C	A	1: 22,428,489	R68L		Het
Rnf157	A	G	11: 116,362,373	F70L	possibly damaging	Het
Rtp3	C	T	9: 110,985,941	C452Y	unknown	Het
S100a14	A	T	3: 90,527,762	K27*	probably null	Het
Scai	C	T	2: 39,106,936	G282D	possibly damaging	Het
Sclt1	A	T	3: 41,717,760	I132N	probably benign	Het
Serpinf1	T	A	11: 75,417,985	Q2L	possibly damaging	Het
Skor2	T	A	18: 76,860,986	V801E	probably benign	Het
Slc16a10	C	G	10: 40,037,259	E484D	probably benign	Het
Slc1a5	T	A	7: 16,797,538	D489E	probably damaging	Het
Slx4	C	T	16: 3,990,786	R430H	probably benign	Het
Teddm1b	A	T	1: 153,874,933	I163F	probably damaging	Het
Tmem171	A	T	13: 98,692,236	C135*	probably null	Het
Tmem82	C	T	4: 141,614,973	R306H	possibly damaging	Het
Tmem94	T	A	11: 115,790,955		probably null	Het
Trrap	T	A	5: 144,794,049	L780Q	probably damaging	Het
Txlnb	A	G	10: 17,842,984	D521G	probably benign	Het
Usp7	T	C	16: 8,716,526	D59G	probably benign	Het
Vcan	G	A	13: 89,725,591	T48I	probably damaging	Het
Vmn1r45	A	G	6: 89,933,334	L218P	probably damaging	Het
Wdr25	A	T	12: 109,024,996	T370S	probably damaging	Het

Other mutations in Trpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00730:Trpm2	APN	10	77942915	splice site	probably null
IGL00773:Trpm2	APN	10	77949214	nonsense	probably null
IGL00962:Trpm2	APN	10	77943916	splice site	probably benign
IGL01093:Trpm2	APN	10	77932280	missense	probably benign	0.04
IGL01124:Trpm2	APN	10	77945825	splice site	probably benign
IGL01301:Trpm2	APN	10	77923984	missense	probably damaging	1.00
IGL02094:Trpm2	APN	10	77942996	nonsense	probably null
IGL02175:Trpm2	APN	10	77937907	missense	probably benign	0.07
IGL02653:Trpm2	APN	10	77912669	missense	probably benign	0.19
IGL02667:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02668:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02828:Trpm2	APN	10	77918986	missense	probably benign	0.16
IGL02951:Trpm2	APN	10	77929278	missense	possibly damaging	0.95
IGL03188:Trpm2	APN	10	77918909	missense	probably benign	0.18
IGL03242:Trpm2	APN	10	77917734	missense	probably benign
IGL03405:Trpm2	APN	10	77966072	splice site	probably benign
Fugit	UTSW	10	77938368	missense	probably damaging	1.00
scusate	UTSW	10	77966994	nonsense	probably null
temporal	UTSW	10	77925682	missense	probably benign	0.30
ANU18:Trpm2	UTSW	10	77923984	missense	probably damaging	1.00
R0147:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0148:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0302:Trpm2	UTSW	10	77943990	splice site	probably benign
R0332:Trpm2	UTSW	10	77947988	missense	probably damaging	1.00
R0586:Trpm2	UTSW	10	77923516	missense	probably damaging	0.99
R0847:Trpm2	UTSW	10	77929288	missense	possibly damaging	0.94
R1183:Trpm2	UTSW	10	77923564	missense	probably damaging	1.00
R1472:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R1510:Trpm2	UTSW	10	77966994	nonsense	probably null
R1518:Trpm2	UTSW	10	77943005	missense	possibly damaging	0.67
R1564:Trpm2	UTSW	10	77942999	missense	probably benign	0.14
R1593:Trpm2	UTSW	10	77943076	missense	possibly damaging	0.71
R1617:Trpm2	UTSW	10	77935875	splice site	probably null
R1673:Trpm2	UTSW	10	77942944	missense	probably benign
R1912:Trpm2	UTSW	10	77945876	missense	probably benign	0.10
R1932:Trpm2	UTSW	10	77941158	missense	probably damaging	1.00
R1993:Trpm2	UTSW	10	77947989	missense	probably damaging	1.00
R2013:Trpm2	UTSW	10	77925766	missense	probably damaging	1.00
R2151:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R2201:Trpm2	UTSW	10	77920471	nonsense	probably null
R2217:Trpm2	UTSW	10	77941182	missense	probably damaging	1.00
R2312:Trpm2	UTSW	10	77918964	missense	probably benign	0.04
R2339:Trpm2	UTSW	10	77914806	splice site	probably benign
R2395:Trpm2	UTSW	10	77947880	missense	possibly damaging	0.69
R2396:Trpm2	UTSW	10	77930637	missense	probably benign	0.14
R2405:Trpm2	UTSW	10	77934724	missense	probably damaging	1.00
R2567:Trpm2	UTSW	10	77941174	missense	probably damaging	0.99
R3001:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3002:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3125:Trpm2	UTSW	10	77911374	missense	probably damaging	1.00
R3500:Trpm2	UTSW	10	77932302	missense	probably benign	0.03
R3777:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R3778:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R4272:Trpm2	UTSW	10	77933642	missense	probably damaging	1.00
R4384:Trpm2	UTSW	10	77917725	missense	probably benign	0.44
R4395:Trpm2	UTSW	10	77929219	missense	probably benign	0.01
R4423:Trpm2	UTSW	10	77935068	missense	probably benign	0.00
R4452:Trpm2	UTSW	10	77923593	missense	probably damaging	1.00
R4612:Trpm2	UTSW	10	77945916	missense	probably damaging	0.99
R4662:Trpm2	UTSW	10	77938138	missense	probably benign	0.05
R4825:Trpm2	UTSW	10	77941173	missense	probably damaging	0.98
R4906:Trpm2	UTSW	10	77932189	nonsense	probably null
R4943:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R4948:Trpm2	UTSW	10	77917792	missense	probably benign	0.34
R5046:Trpm2	UTSW	10	77966018	missense	probably damaging	1.00
R5320:Trpm2	UTSW	10	77923521	missense	probably benign	0.06
R5523:Trpm2	UTSW	10	77935961	missense	probably benign	0.04
R5562:Trpm2	UTSW	10	77959939	missense	possibly damaging	0.71
R5623:Trpm2	UTSW	10	77932139	missense	probably damaging	0.96
R5628:Trpm2	UTSW	10	77912636	missense	probably benign	0.00
R5633:Trpm2	UTSW	10	77938353	missense	possibly damaging	0.71
R5817:Trpm2	UTSW	10	77965980	missense	probably damaging	1.00
R5989:Trpm2	UTSW	10	77959900	missense	probably damaging	1.00
R6018:Trpm2	UTSW	10	77917713	missense	probably benign	0.00
R6075:Trpm2	UTSW	10	77935043	critical splice donor site	probably null
R6092:Trpm2	UTSW	10	77925682	missense	probably benign	0.30
R6309:Trpm2	UTSW	10	77938368	missense	probably damaging	1.00
R6327:Trpm2	UTSW	10	77932227	missense	probably damaging	1.00
R6568:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6579:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6640:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6642:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6798:Trpm2	UTSW	10	77914740	missense	probably damaging	0.99
R6999:Trpm2	UTSW	10	77935891	missense	probably damaging	1.00
R7034:Trpm2	UTSW	10	77912592	missense	probably benign
R7036:Trpm2	UTSW	10	77912592	missense	probably benign
R7113:Trpm2	UTSW	10	77947931	missense	probably damaging	0.96
R7240:Trpm2	UTSW	10	77935876	critical splice donor site	probably null
R7274:Trpm2	UTSW	10	77923555	missense	probably benign	0.00
R7379:Trpm2	UTSW	10	77914734	missense	probably benign
R7527:Trpm2	UTSW	10	77966060	missense	probably benign	0.01
R7571:Trpm2	UTSW	10	77937950	missense	probably benign	0.21
R7600:Trpm2	UTSW	10	77938051	missense	probably benign	0.02
R7727:Trpm2	UTSW	10	77925789	missense	probably benign	0.34
R7771:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R7844:Trpm2	UTSW	10	77923506	missense	probably benign	0.00
R8158:Trpm2	UTSW	10	77947897	missense	probably damaging	0.99
R8225:Trpm2	UTSW	10	77947973	missense	probably damaging	1.00
R8226:Trpm2	UTSW	10	77947973	missense	probably damaging	1.00
R8239:Trpm2	UTSW	10	77936002	missense	probably benign	0.06
R8275:Trpm2	UTSW	10	77966025	nonsense	probably null
R8340:Trpm2	UTSW	10	77923624	nonsense	probably null
R8354:Trpm2	UTSW	10	77933649	missense	probably damaging	1.00
R8427:Trpm2	UTSW	10	77911402	missense	possibly damaging	0.93
R8445:Trpm2	UTSW	10	77910252	missense	probably damaging	1.00
R8769:Trpm2	UTSW	10	77932294	missense	probably benign	0.00
R9144:Trpm2	UTSW	10	77929288	missense	probably benign	0.01
R9286:Trpm2	UTSW	10	77941180	missense	probably benign	0.06
R9319:Trpm2	UTSW	10	77942942	nonsense	probably null
R9319:Trpm2	UTSW	10	77949198	missense	probably damaging	1.00
R9381:Trpm2	UTSW	10	77911357	missense	possibly damaging	0.90
R9457:Trpm2	UTSW	10	77911392	missense	possibly damaging	0.82
R9477:Trpm2	UTSW	10	77911390	missense	probably benign	0.12
R9547:Trpm2	UTSW	10	77912633	missense	probably benign	0.33
R9660:Trpm2	UTSW	10	77930555	missense	probably benign	0.00
R9663:Trpm2	UTSW	10	77920486	missense	probably benign	0.01
Z1177:Trpm2	UTSW	10	77937868	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- ATGAGAGCTTAGCATGCCTACTG -3'
(R):5'- GATACATGCACCTCTGCCTC -3'

Sequencing Primer
(F):5'- AGCATGCCTACTGACTGTCCAG -3'
(R):5'- TGCCTCCCACCAGCTAC -3'

Posted On

2019-06-26