Incidental Mutation 'R0588:Slc26a9'
ID55829
Institutional Source Beutler Lab
Gene Symbol Slc26a9
Ensembl Gene ENSMUSG00000042268
Gene Namesolute carrier family 26, member 9
Synonymsanion transporter/exchanger-9, E030002L01Rik
MMRRC Submission 038778-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.885) question?
Stock #R0588 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location131744022-131771504 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 131754011 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049027] [ENSMUST00000147800] [ENSMUST00000186122]
Predicted Effect probably benign
Transcript: ENSMUST00000049027
SMART Domains Protein: ENSMUSP00000036916
Gene: ENSMUSG00000042268

DomainStartEndE-ValueType
Pfam:Sulfate_transp 71 469 7.4e-99 PFAM
transmembrane domain 473 495 N/A INTRINSIC
Pfam:STAS 520 733 2.8e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130544
Predicted Effect probably benign
Transcript: ENSMUST00000147800
SMART Domains Protein: ENSMUSP00000122075
Gene: ENSMUSG00000042268

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 56 139 5.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186122
SMART Domains Protein: ENSMUSP00000141171
Gene: ENSMUSG00000042268

DomainStartEndE-ValueType
Pfam:Sulfate_transp 150 428 9.6e-58 PFAM
low complexity region 453 462 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (25/25)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one member of a family of sulfate/anion transporter genes. Family members are well conserved in their genomic (number and size of exons) and protein (aa length among species) structures yet have markedly different tissue expression patterns. The product of this gene is a highly selective chloride ion channel regulated by WNK kinases. Alternative splicing results in multiple transcript variants encoding differing isoforms.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced gastric secretory membranes and loss of gastric acid secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,603,061 K1299* probably null Het
Adamts2 G T 11: 50,776,664 W476C probably damaging Het
Ankrd13c T C 3: 158,005,817 F525L probably damaging Het
Arg1 T C 10: 24,920,624 S102G probably damaging Het
Atp2a3 A T 11: 72,973,024 D192V possibly damaging Het
Cabin1 T C 10: 75,745,337 E385G possibly damaging Het
Cacna1h A T 17: 25,387,564 D1020E probably damaging Het
Calcb C T 7: 114,720,126 H48Y probably benign Het
Crtc1 A G 8: 70,439,549 S4P probably damaging Het
Dcaf6 A G 1: 165,420,223 I147T possibly damaging Het
Ears2 T C 7: 122,044,291 probably benign Het
Fas T C 19: 34,327,140 V267A probably damaging Het
Fus T C 7: 127,985,574 L84P probably damaging Het
Fyb T C 15: 6,580,459 V171A probably benign Het
Gdap2 T A 3: 100,170,001 M1K probably null Het
Gprc5b T A 7: 118,983,995 Q217L probably benign Het
Lrrc69 A G 4: 14,704,001 I273T possibly damaging Het
Map4k4 C A 1: 40,004,864 Q556K possibly damaging Het
Npy6r T A 18: 44,275,821 V103E possibly damaging Het
Olfr1449 A G 19: 12,934,747 Y3C probably benign Het
Shisa9 A G 16: 12,267,774 T416A probably damaging Het
Sostdc1 G T 12: 36,317,021 probably benign Het
St18 T A 1: 6,817,738 F510L probably damaging Het
Zdhhc7 A G 8: 120,083,367 probably benign Het
Other mutations in Slc26a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Slc26a9 APN 1 131757528 missense probably damaging 0.97
IGL01131:Slc26a9 APN 1 131755542 splice site probably null
IGL01544:Slc26a9 APN 1 131759495 critical splice donor site probably null
IGL01845:Slc26a9 APN 1 131757518 missense probably damaging 0.99
IGL02125:Slc26a9 APN 1 131759437 missense probably damaging 1.00
IGL02151:Slc26a9 APN 1 131764043 missense probably damaging 1.00
IGL02267:Slc26a9 APN 1 131752845 missense probably damaging 1.00
IGL02469:Slc26a9 APN 1 131762936 missense probably damaging 0.96
IGL03137:Slc26a9 APN 1 131763877 missense probably benign 0.01
IGL03324:Slc26a9 APN 1 131764010 missense probably damaging 1.00
R0611:Slc26a9 UTSW 1 131762761 missense probably damaging 1.00
R0639:Slc26a9 UTSW 1 131763804 missense probably damaging 0.97
R0654:Slc26a9 UTSW 1 131765030 missense probably benign 0.00
R0926:Slc26a9 UTSW 1 131753216 missense probably benign 0.40
R1109:Slc26a9 UTSW 1 131758798 missense probably benign 0.05
R1521:Slc26a9 UTSW 1 131750677 missense probably damaging 1.00
R1728:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1728:Slc26a9 UTSW 1 131766012 missense probably benign
R1729:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1729:Slc26a9 UTSW 1 131766012 missense probably benign
R1730:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1739:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1762:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1762:Slc26a9 UTSW 1 131766012 missense probably benign
R1783:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1783:Slc26a9 UTSW 1 131766012 missense probably benign
R1784:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1784:Slc26a9 UTSW 1 131766012 missense probably benign
R1785:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1785:Slc26a9 UTSW 1 131766012 missense probably benign
R1992:Slc26a9 UTSW 1 131762794 missense probably damaging 1.00
R2198:Slc26a9 UTSW 1 131763263 splice site probably benign
R3008:Slc26a9 UTSW 1 131765914 missense probably damaging 1.00
R3409:Slc26a9 UTSW 1 131763944 missense probably benign
R3879:Slc26a9 UTSW 1 131769231 missense probably benign 0.39
R4064:Slc26a9 UTSW 1 131763187 missense probably benign 0.01
R4088:Slc26a9 UTSW 1 131767849 missense possibly damaging 0.49
R4657:Slc26a9 UTSW 1 131753138 missense probably damaging 1.00
R5005:Slc26a9 UTSW 1 131765887 missense probably damaging 0.99
R6255:Slc26a9 UTSW 1 131763909 missense probably benign 0.00
R6418:Slc26a9 UTSW 1 131758490 missense probably benign 0.06
R6442:Slc26a9 UTSW 1 131758817 missense possibly damaging 0.58
R6674:Slc26a9 UTSW 1 131765018 missense probably benign 0.01
R6719:Slc26a9 UTSW 1 131761785 missense probably benign 0.13
R7202:Slc26a9 UTSW 1 131762788 missense possibly damaging 0.77
R7214:Slc26a9 UTSW 1 131759473 missense probably damaging 0.99
R7238:Slc26a9 UTSW 1 131758818 nonsense probably null
R7389:Slc26a9 UTSW 1 131769248 makesense probably null
R7439:Slc26a9 UTSW 1 131762818 missense probably damaging 1.00
R7441:Slc26a9 UTSW 1 131762818 missense probably damaging 1.00
R7470:Slc26a9 UTSW 1 131764043 missense probably benign 0.33
R7515:Slc26a9 UTSW 1 131753973 missense probably damaging 0.99
R7652:Slc26a9 UTSW 1 131763896 missense probably benign 0.06
R7655:Slc26a9 UTSW 1 131763244 missense possibly damaging 0.88
R7656:Slc26a9 UTSW 1 131763244 missense possibly damaging 0.88
R8278:Slc26a9 UTSW 1 131761776 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GCACACTGCAAACTTCTGACTTCAC -3'
(R):5'- GGCATCTGAAAGGTTCTAGGCAGAC -3'

Sequencing Primer
(F):5'- GTACCTTTGCCGTTATCAGC -3'
(R):5'- TGGTCAAGATAGCTCCATCAG -3'
Posted On2013-07-11