Incidental Mutation 'R7171:Vcan'
ID558299
Institutional Source Beutler Lab
Gene Symbol Vcan
Ensembl Gene ENSMUSG00000021614
Gene Nameversican
SynonymsPG-M, hdf, DPEAAE, heart defect, Cspg2, 5430420N07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7171 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location89655312-89742509 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 89725591 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 48 (T48I)
Ref Sequence ENSEMBL: ENSMUSP00000105173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109543] [ENSMUST00000109544] [ENSMUST00000109546] [ENSMUST00000159337] [ENSMUST00000159910] [ENSMUST00000162715]
Predicted Effect probably benign
Transcript: ENSMUST00000109543
AA Change: T48I

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105170
Gene: ENSMUSG00000021614
AA Change: T48I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
EGF 351 384 2.72e-7 SMART
EGF_CA 386 422 1.16e-10 SMART
CLECT 428 549 3.08e-34 SMART
CCP 555 611 1.04e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109544
AA Change: T48I

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105171
Gene: ENSMUSG00000021614
AA Change: T48I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
EGF 1311 1344 2.72e-7 SMART
EGF_CA 1346 1382 1.16e-10 SMART
CLECT 1388 1509 3.08e-34 SMART
CCP 1515 1571 1.04e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109546
AA Change: T48I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105173
Gene: ENSMUSG00000021614
AA Change: T48I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1546 1569 N/A INTRINSIC
low complexity region 1837 1852 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2354 2367 N/A INTRINSIC
low complexity region 2468 2482 N/A INTRINSIC
low complexity region 2719 2728 N/A INTRINSIC
EGF 3050 3083 2.72e-7 SMART
EGF_CA 3085 3121 1.16e-10 SMART
CLECT 3127 3248 3.08e-34 SMART
CCP 3254 3310 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159337
AA Change: T48I

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000125432
Gene: ENSMUSG00000021614
AA Change: T48I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 354 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159910
AA Change: T48I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125446
Gene: ENSMUSG00000021614
AA Change: T48I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 362 373 N/A INTRINSIC
low complexity region 586 609 N/A INTRINSIC
low complexity region 877 892 N/A INTRINSIC
low complexity region 1053 1066 N/A INTRINSIC
low complexity region 1394 1407 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
low complexity region 1759 1768 N/A INTRINSIC
EGF 2090 2123 2.72e-7 SMART
EGF_CA 2125 2161 1.16e-10 SMART
CLECT 2167 2288 3.08e-34 SMART
CCP 2294 2350 1.04e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162715
AA Change: T48I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125521
Gene: ENSMUSG00000021614
AA Change: T48I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:V-set 23 100 3.9e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the aggrecan/versican proteoglycan family. The protein encoded is a large chondroitin sulfate proteoglycan and is a major component of the extracellular matrix. This protein is involved in cell adhesion, proliferation, proliferation, migration and angiogenesis and plays a central role in tissue morphogenesis and maintenance. Mutations in this gene are the cause of Wagner syndrome type 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for an insertional mutation exhibit anterior-posterior segmental defects of the heart, lack endocardial cushions of the conus and atrioventricular region, and die and around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519P11Rik T C 2: 154,612,977 N154S unknown Het
9530053A07Rik T A 7: 28,154,519 L1636* probably null Het
Ank3 C T 10: 69,992,481 H2327Y Het
Ano6 A G 15: 95,920,291 Y305C probably damaging Het
Apc2 A G 10: 80,315,336 T2075A possibly damaging Het
Arl6 A G 16: 59,623,092 V93A possibly damaging Het
Bcas3 T C 11: 85,583,937 S790P probably damaging Het
Bcl9l C A 9: 44,505,151 H211N probably benign Het
Bptf G T 11: 107,131,407 D172E unknown Het
Card9 T G 2: 26,359,484 I22L possibly damaging Het
Catsperg1 C A 7: 29,185,212 G933V probably damaging Het
Catsperg2 T A 7: 29,705,325 H771L possibly damaging Het
Ccdc66 T C 14: 27,493,272 N281S possibly damaging Het
Cfap54 A T 10: 92,776,210 L3162H probably damaging Het
Clca4a A G 3: 144,958,173 L503P probably benign Het
Cpn1 T C 19: 43,974,031 N160D probably damaging Het
Ctsh T A 9: 90,067,101 I206K probably benign Het
Cyb561d1 G A 3: 108,199,363 T180M probably damaging Het
Dapk1 A T 13: 60,761,785 D1404V probably damaging Het
Dip2c G T 13: 9,506,648 R76L probably benign Het
Dnah7c T C 1: 46,680,738 I2783T probably damaging Het
E130308A19Rik T C 4: 59,690,333 Y56H probably damaging Het
Efemp2 G T 19: 5,480,257 A310S probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Faap24 G A 7: 35,392,854 Q213* probably null Het
Fam181b G A 7: 93,080,735 G239S possibly damaging Het
Fancm T C 12: 65,101,620 W670R probably damaging Het
Fmnl1 T C 11: 103,190,398 Y357H probably damaging Het
Fryl A T 5: 73,122,310 V215E probably damaging Het
Fscn2 C A 11: 120,362,509 N267K probably damaging Het
Fsip2 T A 2: 82,986,227 Y4101* probably null Het
Gcn1l1 G A 5: 115,590,293 V738I probably benign Het
Gdf9 C T 11: 53,437,539 R441C probably damaging Het
Gipc3 C T 10: 81,341,621 G79E probably damaging Het
Gzmf T A 14: 56,205,934 I196L probably benign Het
Hectd1 A T 12: 51,759,297 V1852E probably damaging Het
Hip1r A T 5: 123,995,944 Q256L probably benign Het
Hmgxb4 T C 8: 75,020,262 S405P probably damaging Het
Il9r T A 11: 32,192,671 H294L probably benign Het
Kif12 G A 4: 63,168,694 T331I probably damaging Het
Krtap8-1 A T 16: 89,487,906 M1K probably null Het
Lamc2 A T 1: 153,139,749 C613S probably damaging Het
Lgr4 T A 2: 110,000,969 N314K probably benign Het
Lpcat2 T C 8: 92,909,266 I432T probably benign Het
Mfhas1 T C 8: 35,588,992 V207A probably benign Het
Msh3 T G 13: 92,349,298 T173P probably benign Het
Mup15 T A 4: 61,438,268 M87L probably benign Het
N4bp2 T C 5: 65,808,022 V1138A probably benign Het
Noc2l T C 4: 156,241,722 V422A probably benign Het
Notch3 C T 17: 32,158,962 G74D probably damaging Het
Ocstamp T A 2: 165,398,161 K35I probably benign Het
Olfr360 T C 2: 37,068,388 F28L possibly damaging Het
Olfr459 T G 6: 41,772,027 T91P probably benign Het
Olfr482 A G 7: 108,095,135 V145A probably benign Het
Olfr692 A G 7: 105,368,761 H145R probably benign Het
Plekhh2 T A 17: 84,521,788 V29D probably damaging Het
Pof1b A G X: 112,644,345 I544T probably benign Het
Rad54l2 C T 9: 106,713,478 R483H probably damaging Het
Rapgef6 T A 11: 54,676,363 D1128E possibly damaging Het
Rhbdl2 T A 4: 123,814,256 I86N possibly damaging Het
Rims1 C A 1: 22,428,489 R68L Het
Rnf157 A G 11: 116,362,373 F70L possibly damaging Het
Rtp3 C T 9: 110,985,941 C452Y unknown Het
S100a14 A T 3: 90,527,762 K27* probably null Het
Scai C T 2: 39,106,936 G282D possibly damaging Het
Sclt1 A T 3: 41,717,760 I132N probably benign Het
Serpinf1 T A 11: 75,417,985 Q2L possibly damaging Het
Skor2 T A 18: 76,860,986 V801E probably benign Het
Slc16a10 C G 10: 40,037,259 E484D probably benign Het
Slc1a5 T A 7: 16,797,538 D489E probably damaging Het
Slx4 C T 16: 3,990,786 R430H probably benign Het
Teddm1b A T 1: 153,874,933 I163F probably damaging Het
Tmem171 A T 13: 98,692,236 C135* probably null Het
Tmem82 C T 4: 141,614,973 R306H possibly damaging Het
Tmem94 T A 11: 115,790,955 probably null Het
Trpm2 A C 10: 77,924,014 L1096R probably damaging Het
Trrap T A 5: 144,794,049 L780Q probably damaging Het
Txlnb A G 10: 17,842,984 D521G probably benign Het
Usp7 T C 16: 8,716,526 D59G probably benign Het
Vmn1r45 A G 6: 89,933,334 L218P probably damaging Het
Wdr25 A T 12: 109,024,996 T370S probably damaging Het
Other mutations in Vcan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Vcan APN 13 89704702 missense probably damaging 1.00
IGL00502:Vcan APN 13 89692319 missense probably benign
IGL00504:Vcan APN 13 89691275 missense possibly damaging 0.70
IGL00566:Vcan APN 13 89688979 missense probably benign 0.01
IGL00701:Vcan APN 13 89703726 missense probably benign
IGL00743:Vcan APN 13 89725306 missense probably damaging 0.98
IGL00962:Vcan APN 13 89662052 missense probably damaging 1.00
IGL01085:Vcan APN 13 89679958 missense probably damaging 1.00
IGL01317:Vcan APN 13 89691668 missense probably benign 0.00
IGL01349:Vcan APN 13 89703943 missense probably damaging 0.98
IGL01391:Vcan APN 13 89704169 missense probably benign 0.19
IGL01644:Vcan APN 13 89688675 missense probably benign 0.13
IGL01657:Vcan APN 13 89690586 missense probably damaging 1.00
IGL01707:Vcan APN 13 89689745 missense probably damaging 1.00
IGL01764:Vcan APN 13 89725388 missense probably damaging 1.00
IGL01920:Vcan APN 13 89689205 missense probably benign 0.04
IGL01989:Vcan APN 13 89689359 missense possibly damaging 0.86
IGL01999:Vcan APN 13 89684438 missense probably damaging 1.00
IGL02083:Vcan APN 13 89725565 missense probably damaging 1.00
IGL02160:Vcan APN 13 89684493 missense probably damaging 1.00
IGL02217:Vcan APN 13 89703077 missense probably damaging 1.00
IGL02522:Vcan APN 13 89704849 missense probably benign 0.00
IGL02527:Vcan APN 13 89690657 missense possibly damaging 0.95
IGL02926:Vcan APN 13 89688623 missense probably damaging 0.98
IGL03061:Vcan APN 13 89703275 missense probably benign 0.25
IGL03331:Vcan APN 13 89661932 missense probably damaging 1.00
IGL03352:Vcan APN 13 89705006 missense probably benign 0.00
R0041:Vcan UTSW 13 89661985 missense probably damaging 1.00
R0102:Vcan UTSW 13 89703668 missense probably benign 0.01
R0102:Vcan UTSW 13 89703668 missense probably benign 0.01
R0109:Vcan UTSW 13 89678073 critical splice donor site probably null
R0139:Vcan UTSW 13 89691261 missense probably damaging 1.00
R0295:Vcan UTSW 13 89712191 missense probably benign 0.06
R0375:Vcan UTSW 13 89691275 missense probably damaging 0.99
R0379:Vcan UTSW 13 89703546 missense probably damaging 0.99
R0457:Vcan UTSW 13 89703199 missense possibly damaging 0.78
R0482:Vcan UTSW 13 89678145 missense probably damaging 1.00
R0485:Vcan UTSW 13 89704660 missense possibly damaging 0.92
R0532:Vcan UTSW 13 89703772 missense probably damaging 0.99
R0561:Vcan UTSW 13 89712253 missense probably damaging 1.00
R0561:Vcan UTSW 13 89731464 missense possibly damaging 0.86
R0636:Vcan UTSW 13 89704706 missense probably damaging 0.99
R0636:Vcan UTSW 13 89712267 missense probably damaging 1.00
R0680:Vcan UTSW 13 89679822 missense probably damaging 1.00
R0849:Vcan UTSW 13 89704953 missense possibly damaging 0.75
R1006:Vcan UTSW 13 89685077 critical splice donor site probably null
R1104:Vcan UTSW 13 89692410 missense probably damaging 1.00
R1118:Vcan UTSW 13 89705663 missense probably damaging 1.00
R1137:Vcan UTSW 13 89704303 missense probably damaging 1.00
R1199:Vcan UTSW 13 89679794 splice site probably null
R1219:Vcan UTSW 13 89679904 missense probably damaging 1.00
R1296:Vcan UTSW 13 89657556 missense probably damaging 1.00
R1332:Vcan UTSW 13 89693055 missense probably damaging 1.00
R1336:Vcan UTSW 13 89693055 missense probably damaging 1.00
R1403:Vcan UTSW 13 89688484 missense probably benign 0.00
R1403:Vcan UTSW 13 89688484 missense probably benign 0.00
R1546:Vcan UTSW 13 89692956 missense probably damaging 0.99
R1604:Vcan UTSW 13 89689661 missense probably benign 0.42
R1616:Vcan UTSW 13 89705663 missense probably damaging 1.00
R1636:Vcan UTSW 13 89703667 missense possibly damaging 0.90
R1654:Vcan UTSW 13 89661946 missense probably damaging 1.00
R1680:Vcan UTSW 13 89703547 missense probably benign 0.19
R1694:Vcan UTSW 13 89688483 missense probably damaging 0.98
R1712:Vcan UTSW 13 89721775 missense probably damaging 1.00
R1754:Vcan UTSW 13 89704735 missense probably benign 0.01
R1756:Vcan UTSW 13 89691681 missense probably benign 0.05
R1824:Vcan UTSW 13 89705212 missense possibly damaging 0.75
R1852:Vcan UTSW 13 89705392 missense probably damaging 0.99
R1868:Vcan UTSW 13 89690871 missense probably benign 0.12
R1920:Vcan UTSW 13 89693015 missense probably damaging 1.00
R1932:Vcan UTSW 13 89705534 missense possibly damaging 0.78
R1934:Vcan UTSW 13 89702926 missense probably damaging 1.00
R1942:Vcan UTSW 13 89703424 missense probably benign 0.01
R1964:Vcan UTSW 13 89692742 missense probably benign 0.02
R1970:Vcan UTSW 13 89689038 missense probably damaging 1.00
R2045:Vcan UTSW 13 89690985 missense probably benign 0.00
R2110:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2111:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2112:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2136:Vcan UTSW 13 89689737 missense probably damaging 1.00
R2158:Vcan UTSW 13 89703529 missense possibly damaging 0.68
R2376:Vcan UTSW 13 89703410 missense possibly damaging 0.80
R2385:Vcan UTSW 13 89689449 missense probably damaging 1.00
R2443:Vcan UTSW 13 89704675 missense probably damaging 1.00
R2876:Vcan UTSW 13 89704237 missense probably damaging 1.00
R3607:Vcan UTSW 13 89703301 missense probably damaging 0.98
R4042:Vcan UTSW 13 89692543 missense probably benign 0.35
R4043:Vcan UTSW 13 89692543 missense probably benign 0.35
R4044:Vcan UTSW 13 89692543 missense probably benign 0.35
R4065:Vcan UTSW 13 89679887 missense probably damaging 1.00
R4161:Vcan UTSW 13 89685158 missense probably damaging 1.00
R4178:Vcan UTSW 13 89725547 missense probably damaging 1.00
R4290:Vcan UTSW 13 89725486 missense probably damaging 1.00
R4530:Vcan UTSW 13 89704028 missense probably damaging 0.97
R4666:Vcan UTSW 13 89679934 missense probably damaging 1.00
R4785:Vcan UTSW 13 89705789 missense probably damaging 1.00
R4870:Vcan UTSW 13 89704739 missense probably benign 0.01
R4973:Vcan UTSW 13 89688842 missense probably benign 0.30
R5037:Vcan UTSW 13 89703977 missense probably damaging 1.00
R5104:Vcan UTSW 13 89657472 intron probably benign
R5124:Vcan UTSW 13 89725517 missense probably damaging 1.00
R5129:Vcan UTSW 13 89690240 missense probably damaging 1.00
R5198:Vcan UTSW 13 89690872 missense probably damaging 1.00
R5240:Vcan UTSW 13 89692532 missense probably benign 0.08
R5254:Vcan UTSW 13 89691600 missense probably damaging 0.99
R5280:Vcan UTSW 13 89690286 missense probably benign 0.00
R5522:Vcan UTSW 13 89691810 missense possibly damaging 0.62
R5557:Vcan UTSW 13 89703112 missense possibly damaging 0.77
R5568:Vcan UTSW 13 89688671 missense probably damaging 1.00
R5578:Vcan UTSW 13 89691503 missense probably benign 0.01
R5627:Vcan UTSW 13 89691135 frame shift probably null
R5687:Vcan UTSW 13 89678134 missense probably damaging 1.00
R5752:Vcan UTSW 13 89679950 missense probably damaging 1.00
R5879:Vcan UTSW 13 89703952 missense probably damaging 0.99
R5941:Vcan UTSW 13 89692691 missense probably damaging 0.98
R6113:Vcan UTSW 13 89657536 nonsense probably null
R6135:Vcan UTSW 13 89689926 missense probably benign 0.36
R6252:Vcan UTSW 13 89691220 nonsense probably null
R6280:Vcan UTSW 13 89725373 missense probably damaging 1.00
R6317:Vcan UTSW 13 89691597 missense probably benign 0.22
R6327:Vcan UTSW 13 89704832 missense probably damaging 0.99
R6460:Vcan UTSW 13 89690687 missense possibly damaging 0.61
R6669:Vcan UTSW 13 89704731 missense probably benign 0.21
R6744:Vcan UTSW 13 89705182 missense probably damaging 1.00
R6819:Vcan UTSW 13 89705125 missense probably benign 0.00
R6880:Vcan UTSW 13 89712381 missense probably damaging 1.00
R6956:Vcan UTSW 13 89689431 missense probably damaging 0.99
R6971:Vcan UTSW 13 89678133 missense probably damaging 1.00
R6985:Vcan UTSW 13 89679956 missense probably damaging 1.00
R6994:Vcan UTSW 13 89693407 missense possibly damaging 0.94
R6997:Vcan UTSW 13 89690618 missense probably damaging 0.98
R7029:Vcan UTSW 13 89690241 missense probably damaging 1.00
R7066:Vcan UTSW 13 89705686 missense probably damaging 1.00
R7156:Vcan UTSW 13 89689110 missense possibly damaging 0.95
R7176:Vcan UTSW 13 89688936 missense probably benign 0.01
R7229:Vcan UTSW 13 89705270 missense possibly damaging 0.87
R7250:Vcan UTSW 13 89721686 missense probably damaging 1.00
R7250:Vcan UTSW 13 89731457 critical splice donor site probably null
R7262:Vcan UTSW 13 89705161 missense possibly damaging 0.62
R7289:Vcan UTSW 13 89692733 nonsense probably null
R7299:Vcan UTSW 13 89705266 missense probably benign
R7301:Vcan UTSW 13 89705266 missense probably benign
R7425:Vcan UTSW 13 89689832 missense probably damaging 0.99
R7514:Vcan UTSW 13 89704118 missense probably damaging 0.97
R7579:Vcan UTSW 13 89692458 missense probably damaging 1.00
R7618:Vcan UTSW 13 89692223 missense probably damaging 0.99
R7655:Vcan UTSW 13 89685114 missense probably damaging 1.00
R7656:Vcan UTSW 13 89685114 missense probably damaging 1.00
R7676:Vcan UTSW 13 89691789 missense probably damaging 1.00
R7719:Vcan UTSW 13 89704619 missense probably damaging 0.98
R7753:Vcan UTSW 13 89689323 missense probably damaging 1.00
R7762:Vcan UTSW 13 89692937 missense probably damaging 1.00
R7778:Vcan UTSW 13 89688654 missense probably damaging 1.00
R7824:Vcan UTSW 13 89688654 missense probably damaging 1.00
R7995:Vcan UTSW 13 89691858 missense probably benign
R7998:Vcan UTSW 13 89704327 missense probably damaging 1.00
R8033:Vcan UTSW 13 89704360 missense probably benign 0.04
R8061:Vcan UTSW 13 89657290 missense probably benign 0.45
R8103:Vcan UTSW 13 89657658 missense probably damaging 1.00
R8103:Vcan UTSW 13 89703320 nonsense probably null
R8124:Vcan UTSW 13 89704254 missense possibly damaging 0.93
R8162:Vcan UTSW 13 89704987 nonsense probably null
R8166:Vcan UTSW 13 89692736 missense probably benign 0.02
R8274:Vcan UTSW 13 89704970 missense probably benign 0.02
R8284:Vcan UTSW 13 89704335 missense possibly damaging 0.68
R8417:Vcan UTSW 13 89688743 missense probably benign 0.19
X0058:Vcan UTSW 13 89692493 missense probably benign 0.21
X0065:Vcan UTSW 13 89705749 missense probably damaging 0.96
Z1176:Vcan UTSW 13 89692571 missense probably benign 0.10
Z1177:Vcan UTSW 13 89703524 missense probably benign 0.00
Z1177:Vcan UTSW 13 89703788 nonsense probably null
Z1177:Vcan UTSW 13 89704073 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACTAGCCCGGAGTTTGAC -3'
(R):5'- AATGACAGCTCTGAAACACTTTCC -3'

Sequencing Primer
(F):5'- CATCATCGGGATGTGTAGGCAC -3'
(R):5'- GCTCTGAAACACTTTCCAATCC -3'
Posted On2019-06-26