Incidental Mutation 'R0588:Dcaf6'
List |< first << previous [record 10 of 25] next >> last >|
ID55830
Institutional Source Beutler Lab
Gene Symbol Dcaf6
Ensembl Gene ENSMUSG00000026571
Gene NameDDB1 and CUL4 associated factor 6
SynonymsPC326, 1200006M05Rik, Iqwd1
MMRRC Submission 038778-MU
Accession Numbers

Genbank: NM_028759; MGI: 1921356

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0588 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location165328698-165460475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 165420223 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 147 (I147T)
Ref Sequence ENSEMBL: ENSMUSP00000027856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027856]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027856
AA Change: I147T

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027856
Gene: ENSMUSG00000026571
AA Change: I147T

DomainStartEndE-ValueType
WD40 40 79 5.77e-5 SMART
WD40 82 124 1.2e-2 SMART
WD40 130 170 2.15e-1 SMART
WD40 184 220 3.33e-1 SMART
WD40 238 281 6.66e-1 SMART
low complexity region 364 374 N/A INTRINSIC
low complexity region 499 510 N/A INTRINSIC
low complexity region 669 676 N/A INTRINSIC
IQ 691 713 1.25e1 SMART
WD40 722 763 3.84e0 SMART
WD40 766 805 1.22e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195686
Meta Mutation Damage Score 0.9164 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (25/25)
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,603,061 K1299* probably null Het
Adamts2 G T 11: 50,776,664 W476C probably damaging Het
Ankrd13c T C 3: 158,005,817 F525L probably damaging Het
Arg1 T C 10: 24,920,624 S102G probably damaging Het
Atp2a3 A T 11: 72,973,024 D192V possibly damaging Het
Cabin1 T C 10: 75,745,337 E385G possibly damaging Het
Cacna1h A T 17: 25,387,564 D1020E probably damaging Het
Calcb C T 7: 114,720,126 H48Y probably benign Het
Crtc1 A G 8: 70,439,549 S4P probably damaging Het
Ears2 T C 7: 122,044,291 probably benign Het
Fas T C 19: 34,327,140 V267A probably damaging Het
Fus T C 7: 127,985,574 L84P probably damaging Het
Fyb T C 15: 6,580,459 V171A probably benign Het
Gdap2 T A 3: 100,170,001 M1K probably null Het
Gprc5b T A 7: 118,983,995 Q217L probably benign Het
Lrrc69 A G 4: 14,704,001 I273T possibly damaging Het
Map4k4 C A 1: 40,004,864 Q556K possibly damaging Het
Npy6r T A 18: 44,275,821 V103E possibly damaging Het
Olfr1449 A G 19: 12,934,747 Y3C probably benign Het
Shisa9 A G 16: 12,267,774 T416A probably damaging Het
Slc26a9 C A 1: 131,754,011 probably benign Het
Sostdc1 G T 12: 36,317,021 probably benign Het
St18 T A 1: 6,817,738 F510L probably damaging Het
Zdhhc7 A G 8: 120,083,367 probably benign Het
Other mutations in Dcaf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00828:Dcaf6 APN 1 165338347 splice site probably benign
IGL01377:Dcaf6 APN 1 165388724 missense probably benign 0.01
IGL02027:Dcaf6 APN 1 165424341 missense probably damaging 1.00
IGL02390:Dcaf6 APN 1 165422921 missense possibly damaging 0.50
IGL02754:Dcaf6 APN 1 165338346 critical splice acceptor site probably null
IGL02900:Dcaf6 APN 1 165399775 missense probably damaging 1.00
IGL03119:Dcaf6 APN 1 165339976 missense probably damaging 1.00
IGL03211:Dcaf6 APN 1 165422933 missense possibly damaging 0.55
R1494:Dcaf6 UTSW 1 165333373 missense probably damaging 0.99
R1512:Dcaf6 UTSW 1 165352020 missense probably benign 0.22
R1840:Dcaf6 UTSW 1 165399748 missense probably damaging 0.96
R2191:Dcaf6 UTSW 1 165422864 missense probably benign 0.07
R2297:Dcaf6 UTSW 1 165399862 missense probably damaging 1.00
R3082:Dcaf6 UTSW 1 165422852 splice site probably benign
R3861:Dcaf6 UTSW 1 165429269 missense probably damaging 1.00
R3907:Dcaf6 UTSW 1 165424380 nonsense probably null
R4521:Dcaf6 UTSW 1 165390490 missense probably damaging 0.98
R4531:Dcaf6 UTSW 1 165411467 missense probably damaging 1.00
R4906:Dcaf6 UTSW 1 165411463 critical splice donor site probably null
R4916:Dcaf6 UTSW 1 165420205 missense probably damaging 1.00
R4956:Dcaf6 UTSW 1 165388785 missense probably benign 0.00
R5080:Dcaf6 UTSW 1 165420121 missense probably damaging 1.00
R5091:Dcaf6 UTSW 1 165330003 missense possibly damaging 0.76
R5277:Dcaf6 UTSW 1 165424346 missense probably benign 0.09
R5512:Dcaf6 UTSW 1 165399835 missense possibly damaging 0.84
R5914:Dcaf6 UTSW 1 165351155 missense probably benign
R6004:Dcaf6 UTSW 1 165388685 missense probably benign 0.00
R6239:Dcaf6 UTSW 1 165351270 missense possibly damaging 0.47
R6736:Dcaf6 UTSW 1 165399785 missense possibly damaging 0.77
R7051:Dcaf6 UTSW 1 165424317 missense possibly damaging 0.82
R7110:Dcaf6 UTSW 1 165351968 missense probably benign 0.22
R7583:Dcaf6 UTSW 1 165333310 missense probably damaging 1.00
R7776:Dcaf6 UTSW 1 165352054 nonsense probably null
R7790:Dcaf6 UTSW 1 165399715 missense probably damaging 1.00
R8369:Dcaf6 UTSW 1 165357474 missense probably damaging 1.00
R8411:Dcaf6 UTSW 1 165388675 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AACTGAATCATAACATTTTGCACATCACTTGT -3'
(R):5'- CCATGCACCATGTATTCCATTCGCT -3'

Sequencing Primer
(F):5'- GCACATCACTTGTATAAAACTTGG -3'
(R):5'- gcctcctgcctttaccttc -3'
Posted On2013-07-11