Incidental Mutation 'R0588:Gdap2'
Institutional Source Beutler Lab
Gene Symbol Gdap2
Ensembl Gene ENSMUSG00000027865
Gene Nameganglioside-induced differentiation-associated-protein 2
MMRRC Submission 038778-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0588 (G1)
Quality Score138
Status Validated
Chromosomal Location100162381-100206981 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 100170001 bp
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000102610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029459] [ENSMUST00000106997]
Predicted Effect probably null
Transcript: ENSMUST00000029459
AA Change: M1K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029459
Gene: ENSMUSG00000027865
AA Change: M1K

Pfam:Macro 72 185 1.3e-30 PFAM
low complexity region 265 274 N/A INTRINSIC
SEC14 334 482 5.41e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106997
AA Change: M1K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102610
Gene: ENSMUSG00000027865
AA Change: M1K

Pfam:Macro 72 185 4.4e-32 PFAM
low complexity region 265 274 N/A INTRINSIC
SEC14 334 482 5.41e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150223
Meta Mutation Damage Score 0.9552 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (25/25)
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,603,061 K1299* probably null Het
Adamts2 G T 11: 50,776,664 W476C probably damaging Het
Ankrd13c T C 3: 158,005,817 F525L probably damaging Het
Arg1 T C 10: 24,920,624 S102G probably damaging Het
Atp2a3 A T 11: 72,973,024 D192V possibly damaging Het
Cabin1 T C 10: 75,745,337 E385G possibly damaging Het
Cacna1h A T 17: 25,387,564 D1020E probably damaging Het
Calcb C T 7: 114,720,126 H48Y probably benign Het
Crtc1 A G 8: 70,439,549 S4P probably damaging Het
Dcaf6 A G 1: 165,420,223 I147T possibly damaging Het
Ears2 T C 7: 122,044,291 probably benign Het
Fas T C 19: 34,327,140 V267A probably damaging Het
Fus T C 7: 127,985,574 L84P probably damaging Het
Fyb T C 15: 6,580,459 V171A probably benign Het
Gprc5b T A 7: 118,983,995 Q217L probably benign Het
Lrrc69 A G 4: 14,704,001 I273T possibly damaging Het
Map4k4 C A 1: 40,004,864 Q556K possibly damaging Het
Npy6r T A 18: 44,275,821 V103E possibly damaging Het
Olfr1449 A G 19: 12,934,747 Y3C probably benign Het
Shisa9 A G 16: 12,267,774 T416A probably damaging Het
Slc26a9 C A 1: 131,754,011 probably benign Het
Sostdc1 G T 12: 36,317,021 probably benign Het
St18 T A 1: 6,817,738 F510L probably damaging Het
Zdhhc7 A G 8: 120,083,367 probably benign Het
Other mutations in Gdap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Gdap2 APN 3 100170927 missense possibly damaging 0.62
IGL02342:Gdap2 APN 3 100178316 missense probably damaging 1.00
IGL02684:Gdap2 APN 3 100171020 missense probably benign 0.13
R0128:Gdap2 UTSW 3 100201995 missense probably damaging 1.00
R0130:Gdap2 UTSW 3 100201995 missense probably damaging 1.00
R0344:Gdap2 UTSW 3 100178256 missense probably damaging 1.00
R1521:Gdap2 UTSW 3 100194615 missense possibly damaging 0.61
R2168:Gdap2 UTSW 3 100187883 missense probably benign
R3040:Gdap2 UTSW 3 100188035 critical splice donor site probably null
R4793:Gdap2 UTSW 3 100170918 missense probably damaging 1.00
R5406:Gdap2 UTSW 3 100191675 missense probably damaging 1.00
R5438:Gdap2 UTSW 3 100178313 missense probably damaging 1.00
R5987:Gdap2 UTSW 3 100202256 intron probably benign
R6816:Gdap2 UTSW 3 100191705 critical splice donor site probably null
R7307:Gdap2 UTSW 3 100202033 missense unknown
R7424:Gdap2 UTSW 3 100202066 missense unknown
R7673:Gdap2 UTSW 3 100191699 missense probably benign 0.01
R8221:Gdap2 UTSW 3 100202295 missense unknown
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tccaaaacaggcaaaccaac -3'
Posted On2013-07-11