Incidental Mutation 'R0588:Ankrd13c'
ID55832
Institutional Source Beutler Lab
Gene Symbol Ankrd13c
Ensembl Gene ENSMUSG00000039988
Gene Nameankyrin repeat domain 13c
Synonyms
MMRRC Submission 038778-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.758) question?
Stock #R0588 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location157947239-158008034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 158005817 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 525 (F525L)
Ref Sequence ENSEMBL: ENSMUSP00000125831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040787] [ENSMUST00000121326] [ENSMUST00000164582] [ENSMUST00000199727]
Predicted Effect probably damaging
Transcript: ENSMUST00000040787
AA Change: F525L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038662
Gene: ENSMUSG00000039988
AA Change: F525L

DomainStartEndE-ValueType
low complexity region 27 52 N/A INTRINSIC
low complexity region 69 81 N/A INTRINSIC
Blast:ANK 108 139 8e-10 BLAST
ANK 143 172 2.66e-5 SMART
ANK 176 205 1.97e1 SMART
Pfam:GPCR_chapero_1 259 533 2.2e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121326
SMART Domains Protein: ENSMUSP00000113685
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 40 59 N/A INTRINSIC
RRM 62 136 3.13e-7 SMART
low complexity region 152 176 N/A INTRINSIC
low complexity region 179 202 N/A INTRINSIC
low complexity region 274 352 N/A INTRINSIC
low complexity region 362 444 N/A INTRINSIC
low complexity region 463 470 N/A INTRINSIC
low complexity region 500 509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152274
SMART Domains Protein: ENSMUSP00000127239
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 64 88 N/A INTRINSIC
low complexity region 91 114 N/A INTRINSIC
low complexity region 186 264 N/A INTRINSIC
low complexity region 274 356 N/A INTRINSIC
low complexity region 375 382 N/A INTRINSIC
low complexity region 412 421 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164582
AA Change: F525L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125831
Gene: ENSMUSG00000039988
AA Change: F525L

DomainStartEndE-ValueType
low complexity region 27 52 N/A INTRINSIC
low complexity region 69 81 N/A INTRINSIC
Blast:ANK 108 139 8e-10 BLAST
ANK 143 172 2.66e-5 SMART
ANK 176 205 1.97e1 SMART
Pfam:GPCR_chapero_1 259 532 5.8e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199574
Predicted Effect probably benign
Transcript: ENSMUST00000199727
SMART Domains Protein: ENSMUSP00000143432
Gene: ENSMUSG00000039988

DomainStartEndE-ValueType
low complexity region 27 52 N/A INTRINSIC
low complexity region 69 81 N/A INTRINSIC
Blast:ANK 108 139 2e-9 BLAST
ANK 143 172 1.7e-7 SMART
ANK 176 205 1.3e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199757
Meta Mutation Damage Score 0.6580 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (25/25)
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,603,061 K1299* probably null Het
Adamts2 G T 11: 50,776,664 W476C probably damaging Het
Arg1 T C 10: 24,920,624 S102G probably damaging Het
Atp2a3 A T 11: 72,973,024 D192V possibly damaging Het
Cabin1 T C 10: 75,745,337 E385G possibly damaging Het
Cacna1h A T 17: 25,387,564 D1020E probably damaging Het
Calcb C T 7: 114,720,126 H48Y probably benign Het
Crtc1 A G 8: 70,439,549 S4P probably damaging Het
Dcaf6 A G 1: 165,420,223 I147T possibly damaging Het
Ears2 T C 7: 122,044,291 probably benign Het
Fas T C 19: 34,327,140 V267A probably damaging Het
Fus T C 7: 127,985,574 L84P probably damaging Het
Fyb T C 15: 6,580,459 V171A probably benign Het
Gdap2 T A 3: 100,170,001 M1K probably null Het
Gprc5b T A 7: 118,983,995 Q217L probably benign Het
Lrrc69 A G 4: 14,704,001 I273T possibly damaging Het
Map4k4 C A 1: 40,004,864 Q556K possibly damaging Het
Npy6r T A 18: 44,275,821 V103E possibly damaging Het
Olfr1449 A G 19: 12,934,747 Y3C probably benign Het
Shisa9 A G 16: 12,267,774 T416A probably damaging Het
Slc26a9 C A 1: 131,754,011 probably benign Het
Sostdc1 G T 12: 36,317,021 probably benign Het
St18 T A 1: 6,817,738 F510L probably damaging Het
Zdhhc7 A G 8: 120,083,367 probably benign Het
Other mutations in Ankrd13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Ankrd13c APN 3 157947934 missense probably damaging 0.97
IGL02943:Ankrd13c APN 3 157947927 missense probably damaging 1.00
R0449:Ankrd13c UTSW 3 157991714 missense probably benign 0.26
R0787:Ankrd13c UTSW 3 157994678 missense probably null 0.98
R1459:Ankrd13c UTSW 3 157972310 missense probably damaging 1.00
R1530:Ankrd13c UTSW 3 157991721 missense probably damaging 1.00
R1534:Ankrd13c UTSW 3 158001120 missense probably benign 0.01
R4632:Ankrd13c UTSW 3 157962302 missense probably damaging 0.99
R4946:Ankrd13c UTSW 3 158005773 missense probably damaging 1.00
R5154:Ankrd13c UTSW 3 157988660 missense possibly damaging 0.51
R5672:Ankrd13c UTSW 3 157961027 critical splice donor site probably null
R5935:Ankrd13c UTSW 3 157947583 synonymous silent
R6562:Ankrd13c UTSW 3 157999672 missense probably damaging 1.00
R7358:Ankrd13c UTSW 3 157991737 nonsense probably null
R7768:Ankrd13c UTSW 3 157988647 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TGTGTGATAGAAGGTGGCTGACTCC -3'
(R):5'- TCTCAGGGTCACTGGGTGTCAAAC -3'

Sequencing Primer
(F):5'- CTGACTCCAGTGGGCTATCAAAG -3'
(R):5'- GGTCACTGGGTGTCAAACTATTAC -3'
Posted On2013-07-11