Incidental Mutation 'R7172:Ryr3'
ID558324
Institutional Source Beutler Lab
Gene Symbol Ryr3
Ensembl Gene ENSMUSG00000057378
Gene Nameryanodine receptor 3
Synonymscalcium release channel isoform 3
MMRRC Submission
Accession Numbers

Genbank: NM_177652.2

Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock #R7172 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location112631355-113217096 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112661657 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 3783 (N3783I)
Ref Sequence ENSEMBL: ENSMUSP00000089426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080673] [ENSMUST00000091818] [ENSMUST00000134358] [ENSMUST00000208151] [ENSMUST00000208290]
Predicted Effect probably damaging
Transcript: ENSMUST00000080673
AA Change: N3758I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079503
Gene: ENSMUSG00000057378
AA Change: N3758I

DomainStartEndE-ValueType
low complexity region 90 99 N/A INTRINSIC
MIR 100 155 3.27e-4 SMART
MIR 162 207 7.52e-4 SMART
MIR 215 269 8.06e-4 SMART
MIR 275 368 8.4e-25 SMART
Pfam:RYDR_ITPR 438 642 1.1e-71 PFAM
SPRY 657 795 1.16e-24 SMART
Pfam:RyR 848 942 1.5e-34 PFAM
Pfam:RyR 962 1056 1.2e-32 PFAM
SPRY 1084 1207 7.99e-37 SMART
SPRY 1325 1465 6.25e-30 SMART
low complexity region 1757 1772 N/A INTRINSIC
low complexity region 1773 1788 N/A INTRINSIC
low complexity region 1932 1957 N/A INTRINSIC
Pfam:RYDR_ITPR 2018 2228 1.8e-59 PFAM
Pfam:RyR 2595 2689 1.2e-36 PFAM
Pfam:RyR 2713 2801 2.1e-31 PFAM
low complexity region 2877 2887 N/A INTRINSIC
low complexity region 3169 3184 N/A INTRINSIC
low complexity region 3327 3338 N/A INTRINSIC
PDB:2BCX|B 3462 3491 9e-12 PDB
low complexity region 3532 3540 N/A INTRINSIC
coiled coil region 3585 3614 N/A INTRINSIC
Pfam:RIH_assoc 3715 3848 4.9e-40 PFAM
low complexity region 3855 3875 N/A INTRINSIC
SCOP:d1sra__ 3893 3989 1e-10 SMART
low complexity region 4096 4134 N/A INTRINSIC
transmembrane domain 4178 4200 N/A INTRINSIC
Pfam:RR_TM4-6 4227 4497 4.7e-96 PFAM
Pfam:Ion_trans 4599 4762 2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091818
AA Change: N3783I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089426
Gene: ENSMUSG00000057378
AA Change: N3783I

DomainStartEndE-ValueType
low complexity region 110 119 N/A INTRINSIC
MIR 120 175 3.27e-4 SMART
MIR 182 227 7.52e-4 SMART
MIR 235 289 8.06e-4 SMART
MIR 295 388 8.4e-25 SMART
Pfam:RYDR_ITPR 460 655 1.2e-64 PFAM
SPRY 677 815 1.16e-24 SMART
Pfam:RyR 869 959 3.3e-38 PFAM
Pfam:RyR 983 1073 2.5e-32 PFAM
SPRY 1104 1227 7.99e-37 SMART
SPRY 1345 1485 6.25e-30 SMART
low complexity region 1777 1792 N/A INTRINSIC
low complexity region 1793 1808 N/A INTRINSIC
low complexity region 1952 1977 N/A INTRINSIC
Pfam:RYDR_ITPR 2040 2248 5.8e-67 PFAM
Pfam:RyR 2616 2706 6.3e-33 PFAM
Pfam:RyR 2734 2818 6.6e-26 PFAM
low complexity region 2897 2907 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
PDB:2BCX|B 3487 3516 1e-11 PDB
low complexity region 3557 3565 N/A INTRINSIC
coiled coil region 3610 3639 N/A INTRINSIC
Pfam:RIH_assoc 3744 3862 3.5e-34 PFAM
low complexity region 3880 3900 N/A INTRINSIC
SCOP:d1sra__ 3918 4014 1e-10 SMART
low complexity region 4121 4159 N/A INTRINSIC
transmembrane domain 4203 4225 N/A INTRINSIC
Pfam:RR_TM4-6 4252 4522 1.1e-98 PFAM
Pfam:Ion_trans 4625 4799 6.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134358
AA Change: N3753I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208151
AA Change: N3758I

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000208290
AA Change: N3763I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ryanodine receptor, which functions to release calcium from intracellular storage for use in many cellular processes. For example, the encoded protein is involved in skeletal muscle contraction by releasing calcium from the sarcoplasmic reticulum followed by depolarization of T-tubules. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired muscle contraction at an early age, changes in hippocampal synaptic plasticity, increased locomotor activity with a tendency to circle, and impaired relearning of a spatial task. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(5) Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA467197 A T 2: 122,638,318 Y33F probably damaging Het
Abca4 C T 3: 122,103,540 Q623* probably null Het
Abcb1a A T 5: 8,702,399 I457F probably benign Het
Abcb9 G A 5: 124,062,806 Q716* probably null Het
Abhd15 T C 11: 77,515,296 V33A probably benign Het
Abl2 A G 1: 156,622,587 D108G probably damaging Het
Adamts3 G A 5: 89,883,001 probably benign Het
Atmin G T 8: 116,956,542 V314L probably damaging Het
Axl G T 7: 25,786,974 Q102K probably benign Het
B020004J07Rik A G 4: 101,836,996 V230A probably benign Het
Cdhr5 A G 7: 141,271,928 S488P possibly damaging Het
Cnn1 C A 9: 22,105,494 A126D probably damaging Het
Col25a1 A T 3: 130,570,332 K537* probably null Het
Cxcl2 A G 5: 90,904,020 T26A probably benign Het
Dcc T C 18: 71,378,684 T887A probably benign Het
Dhx36 T C 3: 62,501,015 D134G probably benign Het
Dnah17 T A 11: 118,041,131 K3672* probably null Het
Fadd G T 7: 144,582,171 H73Q probably benign Het
Fam35a G A 14: 34,237,568 T819I probably damaging Het
Fancm A G 12: 65,106,054 N1095D possibly damaging Het
Fhod3 T C 18: 25,085,546 S789P probably damaging Het
Glis2 G A 16: 4,613,475 V289I probably benign Het
Gm17728 A C 17: 9,422,388 D110A probably damaging Het
Gm9602 T A 14: 4,777,282 S45T possibly damaging Het
Gpr137 A G 19: 6,939,681 S161P possibly damaging Het
Gpr89 C T 3: 96,880,069 probably null Het
Gps2 C T 11: 69,916,436 T306I probably benign Het
Hmcn1 A G 1: 150,753,699 Y936H possibly damaging Het
Hoxa5 A G 6: 52,204,296 Y19H probably damaging Het
Ifit2 G T 19: 34,573,494 A145S probably benign Het
Impdh2 G T 9: 108,560,610 C26F probably benign Het
Kcnh6 T C 11: 106,020,274 Y552H possibly damaging Het
Kcnma1 A T 14: 23,526,623 M254K probably damaging Het
Klhdc9 A T 1: 171,360,660 M1K probably null Het
Klk1b11 A T 7: 43,999,247 D194V possibly damaging Het
Lama1 A G 17: 67,804,545 I2264V Het
Lmntd2 A G 7: 141,213,641 S111P unknown Het
Megf8 T C 7: 25,343,667 L1338P probably damaging Het
Mipol1 G A 12: 57,325,535 E127K possibly damaging Het
Mmp25 A T 17: 23,644,788 C23S probably benign Het
Mup8 A T 4: 60,222,425 C15* probably null Het
Myh2 A T 11: 67,188,701 T995S probably benign Het
Myo1d C T 11: 80,592,795 V863I probably benign Het
N4bp1 A G 8: 86,860,424 probably null Het
Nat10 G T 2: 103,732,969 P562T probably damaging Het
Nedd9 C G 13: 41,316,804 R291P probably benign Het
Nlrc3 G T 16: 3,963,753 H613Q probably benign Het
Ntn1 A T 11: 68,385,667 C152S probably damaging Het
Olfr332 T A 11: 58,489,745 I337F unknown Het
Pam A T 1: 97,834,478 D793E probably benign Het
Patz1 T G 11: 3,308,032 V631G probably benign Het
Pcdh15 G A 10: 74,502,765 V1068M probably damaging Het
Prmt5 A G 14: 54,514,886 F151S possibly damaging Het
Pygo2 G A 3: 89,432,636 V114I probably benign Het
Rabgap1l A T 1: 160,733,586 S220R probably benign Het
Rdh7 T G 10: 127,888,349 S89R possibly damaging Het
Rgsl1 A C 1: 153,826,220 W163G possibly damaging Het
Slit1 A G 19: 41,634,666 L644P probably damaging Het
Steap2 A G 5: 5,682,896 S43P possibly damaging Het
Susd1 A T 4: 59,315,420 probably null Het
Tbc1d9 A G 8: 83,254,761 M686V probably damaging Het
Tdrp G A 8: 13,974,579 R22* probably null Het
Tmem245 A G 4: 56,903,946 V598A possibly damaging Het
Tnxb A G 17: 34,696,020 E1994G probably damaging Het
Trcg1 T A 9: 57,248,335 V757E probably benign Het
Trim10 A G 17: 36,870,063 E62G possibly damaging Het
Ushbp1 G T 8: 71,388,766 A473E possibly damaging Het
Vmn1r50 A C 6: 90,107,404 K44Q possibly damaging Het
Wdr75 A G 1: 45,799,134 N68D probably damaging Het
Wdr83 A G 8: 85,079,824 V115A probably damaging Het
Zdhhc17 A G 10: 111,009,948 L28P possibly damaging Het
Zfp738 C T 13: 67,670,408 C488Y probably damaging Het
Zfp987 T G 4: 146,122,002 L50W probably damaging Het
Zfyve28 G T 5: 34,234,409 R133S probably benign Het
Zscan20 G T 4: 128,585,676 C1007* probably null Het
Other mutations in Ryr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Ryr3 APN 2 112660149 missense probably damaging 0.98
IGL00531:Ryr3 APN 2 112663012 splice site probably benign
IGL00785:Ryr3 APN 2 112836103 missense possibly damaging 0.95
IGL00901:Ryr3 APN 2 112886589 missense probably damaging 1.00
IGL00910:Ryr3 APN 2 112728934 splice site probably benign
IGL00970:Ryr3 APN 2 112764676 missense probably damaging 1.00
IGL01083:Ryr3 APN 2 112751846 splice site probably benign
IGL01105:Ryr3 APN 2 112751805 missense probably damaging 1.00
IGL01287:Ryr3 APN 2 112709073 missense probably damaging 1.00
IGL01343:Ryr3 APN 2 112660054 missense probably damaging 1.00
IGL01472:Ryr3 APN 2 112672248 missense probably benign 0.20
IGL01552:Ryr3 APN 2 112825883 missense possibly damaging 0.53
IGL01594:Ryr3 APN 2 112772728 missense probably damaging 1.00
IGL01723:Ryr3 APN 2 112650111 critical splice donor site probably null
IGL01837:Ryr3 APN 2 112801320 missense probably damaging 1.00
IGL01868:Ryr3 APN 2 112803158 splice site probably benign
IGL01907:Ryr3 APN 2 112869001 splice site probably benign
IGL02005:Ryr3 APN 2 112663263 splice site probably benign
IGL02014:Ryr3 APN 2 112946915 missense possibly damaging 0.86
IGL02109:Ryr3 APN 2 112949157 missense probably benign
IGL02178:Ryr3 APN 2 112825799 missense probably benign 0.17
IGL02185:Ryr3 APN 2 112967203 missense probably damaging 0.99
IGL02189:Ryr3 APN 2 112754838 splice site probably benign
IGL02200:Ryr3 APN 2 112849510 missense probably damaging 0.98
IGL02302:Ryr3 APN 2 112964356 missense probably damaging 1.00
IGL02305:Ryr3 APN 2 112645277 missense probably damaging 0.96
IGL02306:Ryr3 APN 2 112834114 missense probably damaging 0.98
IGL02306:Ryr3 APN 2 112847399 critical splice donor site probably null
IGL02340:Ryr3 APN 2 112947004 splice site probably benign
IGL02398:Ryr3 APN 2 112847422 missense probably benign 0.05
IGL02407:Ryr3 APN 2 112754958 missense probably damaging 1.00
IGL02426:Ryr3 APN 2 112900905 missense possibly damaging 0.59
IGL02452:Ryr3 APN 2 112833990 missense probably damaging 1.00
IGL02453:Ryr3 APN 2 112681728 splice site probably benign
IGL02585:Ryr3 APN 2 112712303 missense probably damaging 1.00
IGL02724:Ryr3 APN 2 112902576 critical splice donor site probably null
IGL02817:Ryr3 APN 2 112844623 critical splice donor site probably null
IGL02861:Ryr3 APN 2 112652841 missense possibly damaging 0.89
IGL03038:Ryr3 APN 2 112668120 missense possibly damaging 0.83
IGL03059:Ryr3 APN 2 112800047 missense probably damaging 1.00
IGL03136:Ryr3 APN 2 112675974 splice site probably benign
IGL03137:Ryr3 APN 2 112910397 missense probably benign
IGL03166:Ryr3 APN 2 112641112 nonsense probably null
IGL03177:Ryr3 APN 2 113028671 missense probably benign 0.39
IGL03205:Ryr3 APN 2 112632142 missense probably damaging 1.00
IGL03224:Ryr3 APN 2 112954336 nonsense probably null
IGL03249:Ryr3 APN 2 112640656 missense probably benign 0.32
IGL03370:Ryr3 APN 2 112756599 missense possibly damaging 0.69
ANU74:Ryr3 UTSW 2 112831230 critical splice acceptor site probably null
F5426:Ryr3 UTSW 2 112766338 splice site probably benign
PIT4494001:Ryr3 UTSW 2 112841876 missense probably damaging 0.99
R0022:Ryr3 UTSW 2 112640666 missense probably damaging 1.00
R0022:Ryr3 UTSW 2 112640666 missense probably damaging 1.00
R0051:Ryr3 UTSW 2 112869075 missense probably damaging 1.00
R0051:Ryr3 UTSW 2 112869075 missense probably damaging 1.00
R0085:Ryr3 UTSW 2 112859763 missense probably damaging 1.00
R0097:Ryr3 UTSW 2 112800055 missense probably damaging 1.00
R0097:Ryr3 UTSW 2 112800055 missense probably damaging 1.00
R0098:Ryr3 UTSW 2 112901031 missense probably damaging 1.00
R0098:Ryr3 UTSW 2 112901031 missense probably damaging 1.00
R0116:Ryr3 UTSW 2 112803165 missense probably damaging 0.99
R0281:Ryr3 UTSW 2 112686810 missense probably damaging 1.00
R0302:Ryr3 UTSW 2 112647123 splice site probably benign
R0306:Ryr3 UTSW 2 112775655 critical splice donor site probably null
R0445:Ryr3 UTSW 2 112866054 missense probably benign 0.16
R0463:Ryr3 UTSW 2 112661701 missense probably damaging 1.00
R0592:Ryr3 UTSW 2 112678481 missense probably damaging 1.00
R0622:Ryr3 UTSW 2 112662555 missense probably damaging 1.00
R0656:Ryr3 UTSW 2 112648306 splice site probably benign
R0735:Ryr3 UTSW 2 112732982 missense probably benign 0.11
R0783:Ryr3 UTSW 2 112756327 splice site probably benign
R0789:Ryr3 UTSW 2 112780973 splice site probably null
R0835:Ryr3 UTSW 2 112650138 missense probably benign 0.16
R0879:Ryr3 UTSW 2 113030243 missense probably benign 0.02
R0924:Ryr3 UTSW 2 112841833 missense probably damaging 1.00
R0930:Ryr3 UTSW 2 112841833 missense probably damaging 1.00
R0931:Ryr3 UTSW 2 112653702 missense probably damaging 1.00
R1037:Ryr3 UTSW 2 112869108 missense probably benign 0.42
R1169:Ryr3 UTSW 2 112733014 missense probably benign 0.01
R1170:Ryr3 UTSW 2 112946987 missense probably damaging 1.00
R1178:Ryr3 UTSW 2 112964380 missense probably benign 0.00
R1187:Ryr3 UTSW 2 112958176 missense probably damaging 1.00
R1289:Ryr3 UTSW 2 112645285 missense probably damaging 1.00
R1337:Ryr3 UTSW 2 112779963 missense possibly damaging 0.46
R1342:Ryr3 UTSW 2 112750803 missense probably damaging 1.00
R1349:Ryr3 UTSW 2 112834201 missense probably damaging 1.00
R1372:Ryr3 UTSW 2 112834201 missense probably damaging 1.00
R1434:Ryr3 UTSW 2 112645259 missense probably damaging 1.00
R1438:Ryr3 UTSW 2 112757701 missense probably benign 0.18
R1467:Ryr3 UTSW 2 112753002 splice site probably benign
R1470:Ryr3 UTSW 2 112653007 missense probably benign
R1470:Ryr3 UTSW 2 112653007 missense probably benign
R1474:Ryr3 UTSW 2 112909962 missense probably damaging 1.00
R1481:Ryr3 UTSW 2 112636522 splice site probably benign
R1513:Ryr3 UTSW 2 112709197 nonsense probably null
R1524:Ryr3 UTSW 2 112869082 missense probably damaging 0.98
R1525:Ryr3 UTSW 2 112678090 missense probably damaging 1.00
R1526:Ryr3 UTSW 2 112661657 missense probably damaging 1.00
R1611:Ryr3 UTSW 2 112653505 missense possibly damaging 0.72
R1640:Ryr3 UTSW 2 112900833 missense probably damaging 1.00
R1662:Ryr3 UTSW 2 112709273 missense probably damaging 0.99
R1764:Ryr3 UTSW 2 112860460 missense probably damaging 1.00
R1769:Ryr3 UTSW 2 112751768 critical splice donor site probably null
R1776:Ryr3 UTSW 2 112957253 missense probably damaging 0.99
R1780:Ryr3 UTSW 2 112867292 missense probably damaging 0.98
R1840:Ryr3 UTSW 2 112750820 missense probably damaging 1.00
R1864:Ryr3 UTSW 2 112730328 missense possibly damaging 0.65
R1872:Ryr3 UTSW 2 112709137 missense possibly damaging 0.94
R1960:Ryr3 UTSW 2 112794467 missense probably damaging 1.00
R1994:Ryr3 UTSW 2 112654492 missense probably null 0.93
R2018:Ryr3 UTSW 2 112781065 missense probably benign 0.24
R2019:Ryr3 UTSW 2 112781065 missense probably benign 0.24
R2029:Ryr3 UTSW 2 112647016 missense possibly damaging 0.82
R2051:Ryr3 UTSW 2 112756641 missense probably damaging 1.00
R2060:Ryr3 UTSW 2 112954364 missense possibly damaging 0.92
R2061:Ryr3 UTSW 2 112663004 missense possibly damaging 0.83
R2067:Ryr3 UTSW 2 112946957 missense probably damaging 1.00
R2106:Ryr3 UTSW 2 112638129 missense probably damaging 1.00
R2129:Ryr3 UTSW 2 112678370 splice site probably benign
R2140:Ryr3 UTSW 2 112875148 missense probably benign 0.01
R2176:Ryr3 UTSW 2 112666335 missense possibly damaging 0.48
R2241:Ryr3 UTSW 2 112801392 missense probably damaging 1.00
R2261:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R2262:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R2276:Ryr3 UTSW 2 112649319 missense possibly damaging 0.79
R2279:Ryr3 UTSW 2 112649319 missense possibly damaging 0.79
R2403:Ryr3 UTSW 2 112686628 missense probably damaging 1.00
R2510:Ryr3 UTSW 2 112675904 missense probably benign 0.18
R2568:Ryr3 UTSW 2 112675874 missense probably damaging 1.00
R3013:Ryr3 UTSW 2 112640281 missense probably damaging 1.00
R3431:Ryr3 UTSW 2 112656531 missense probably damaging 1.00
R3552:Ryr3 UTSW 2 112751787 missense probably damaging 1.00
R3761:Ryr3 UTSW 2 112754913 missense probably benign
R3909:Ryr3 UTSW 2 112636608 missense probably damaging 1.00
R3923:Ryr3 UTSW 2 112841873 missense possibly damaging 0.92
R3924:Ryr3 UTSW 2 113028703 splice site probably benign
R3927:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R3947:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R3949:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R3976:Ryr3 UTSW 2 112675837 missense possibly damaging 0.49
R4004:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R4022:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R4084:Ryr3 UTSW 2 112900908 missense probably damaging 0.99
R4106:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R4108:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R4109:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R4131:Ryr3 UTSW 2 112926983 splice site probably null
R4156:Ryr3 UTSW 2 112653675 missense probably damaging 1.00
R4172:Ryr3 UTSW 2 112794470 missense probably damaging 1.00
R4234:Ryr3 UTSW 2 112910407 missense probably damaging 1.00
R4399:Ryr3 UTSW 2 112946844 missense probably benign 0.01
R4409:Ryr3 UTSW 2 112730308 missense probably damaging 1.00
R4418:Ryr3 UTSW 2 112831224 missense probably damaging 1.00
R4466:Ryr3 UTSW 2 112653102 missense possibly damaging 0.92
R4525:Ryr3 UTSW 2 112653621 missense probably damaging 0.98
R4573:Ryr3 UTSW 2 112755174 splice site probably null
R4589:Ryr3 UTSW 2 112875133 missense probably damaging 1.00
R4653:Ryr3 UTSW 2 112652763 missense probably damaging 1.00
R4664:Ryr3 UTSW 2 112996555 intron probably benign
R4710:Ryr3 UTSW 2 112766301 missense probably damaging 1.00
R4734:Ryr3 UTSW 2 112910502 missense probably damaging 0.99
R4741:Ryr3 UTSW 2 112803268 missense probably damaging 0.99
R4748:Ryr3 UTSW 2 112964405 missense possibly damaging 0.95
R4749:Ryr3 UTSW 2 112964405 missense possibly damaging 0.95
R4754:Ryr3 UTSW 2 112757639 missense possibly damaging 0.94
R4764:Ryr3 UTSW 2 112733031 critical splice acceptor site probably null
R4812:Ryr3 UTSW 2 112912236 missense probably damaging 1.00
R4822:Ryr3 UTSW 2 112652745 missense probably damaging 1.00
R4841:Ryr3 UTSW 2 112648373 missense probably damaging 1.00
R4849:Ryr3 UTSW 2 112908462 missense probably damaging 1.00
R4917:Ryr3 UTSW 2 112831185 missense probably damaging 1.00
R4942:Ryr3 UTSW 2 112836257 missense probably damaging 0.99
R4990:Ryr3 UTSW 2 112635777 missense probably damaging 1.00
R4990:Ryr3 UTSW 2 112909973 missense probably damaging 1.00
R5049:Ryr3 UTSW 2 112640171 missense probably damaging 1.00
R5055:Ryr3 UTSW 2 112831159 missense probably benign 0.00
R5112:Ryr3 UTSW 2 112902665 missense probably damaging 1.00
R5160:Ryr3 UTSW 2 112646927 missense probably damaging 1.00
R5169:Ryr3 UTSW 2 112670660 missense possibly damaging 0.63
R5176:Ryr3 UTSW 2 112757667 missense possibly damaging 0.95
R5182:Ryr3 UTSW 2 112755150 missense probably damaging 1.00
R5206:Ryr3 UTSW 2 112844711 missense probably damaging 1.00
R5263:Ryr3 UTSW 2 112718002 missense possibly damaging 0.65
R5272:Ryr3 UTSW 2 112653213 missense probably damaging 1.00
R5332:Ryr3 UTSW 2 112902693 missense probably damaging 1.00
R5340:Ryr3 UTSW 2 112834125 missense probably damaging 0.99
R5359:Ryr3 UTSW 2 112775841 splice site probably null
R5434:Ryr3 UTSW 2 112794469 missense probably damaging 1.00
R5454:Ryr3 UTSW 2 112730302 splice site probably null
R5501:Ryr3 UTSW 2 112662504 missense possibly damaging 0.80
R5560:Ryr3 UTSW 2 112754877 missense probably damaging 1.00
R5580:Ryr3 UTSW 2 112841948 missense probably damaging 1.00
R5621:Ryr3 UTSW 2 112900984 nonsense probably null
R5731:Ryr3 UTSW 2 112641572 missense probably damaging 1.00
R5757:Ryr3 UTSW 2 112841975 missense probably damaging 1.00
R5758:Ryr3 UTSW 2 112841975 missense probably damaging 1.00
R5768:Ryr3 UTSW 2 112753097 missense probably benign 0.05
R5783:Ryr3 UTSW 2 112652998 missense probably benign 0.06
R5799:Ryr3 UTSW 2 112686580 missense probably damaging 1.00
R5829:Ryr3 UTSW 2 112859731 missense probably damaging 1.00
R5883:Ryr3 UTSW 2 113030292 intron probably benign
R5911:Ryr3 UTSW 2 112908487 missense probably damaging 1.00
R5968:Ryr3 UTSW 2 112647049 missense probably benign 0.22
R5972:Ryr3 UTSW 2 112834064 missense probably damaging 0.99
R5978:Ryr3 UTSW 2 112672269 missense probably benign 0.00
R6084:Ryr3 UTSW 2 112908493 missense probably damaging 1.00
R6117:Ryr3 UTSW 2 112635396 missense probably damaging 1.00
R6126:Ryr3 UTSW 2 112757670 missense probably damaging 1.00
R6128:Ryr3 UTSW 2 112954294 critical splice donor site probably null
R6157:Ryr3 UTSW 2 112841899 missense probably damaging 0.98
R6258:Ryr3 UTSW 2 112660104 missense probably damaging 1.00
R6260:Ryr3 UTSW 2 112660104 missense probably damaging 1.00
R6373:Ryr3 UTSW 2 112656544 missense probably damaging 1.00
R6377:Ryr3 UTSW 2 112632185 missense probably damaging 1.00
R6443:Ryr3 UTSW 2 112675933 missense possibly damaging 0.88
R6478:Ryr3 UTSW 2 112660068 missense probably damaging 1.00
R6512:Ryr3 UTSW 2 112867378 missense possibly damaging 0.83
R6684:Ryr3 UTSW 2 112753088 missense probably damaging 1.00
R6753:Ryr3 UTSW 2 112652610 missense probably damaging 0.99
R6812:Ryr3 UTSW 2 112946906 missense probably damaging 1.00
R6910:Ryr3 UTSW 2 112958175 missense probably damaging 1.00
R6930:Ryr3 UTSW 2 112860354 missense probably damaging 1.00
R6946:Ryr3 UTSW 2 112831200 missense probably damaging 1.00
R6950:Ryr3 UTSW 2 112686825 missense possibly damaging 0.78
R6973:Ryr3 UTSW 2 112766311 missense probably damaging 0.99
R6984:Ryr3 UTSW 2 112875091 missense probably damaging 1.00
R7020:Ryr3 UTSW 2 112753078 missense probably benign 0.00
R7037:Ryr3 UTSW 2 112949130 nonsense probably null
R7166:Ryr3 UTSW 2 112875028 missense probably damaging 1.00
R7177:Ryr3 UTSW 2 112900843 missense probably damaging 1.00
R7188:Ryr3 UTSW 2 113028644 missense probably damaging 1.00
R7202:Ryr3 UTSW 2 112766319 missense probably damaging 1.00
R7228:Ryr3 UTSW 2 112861852 missense probably damaging 1.00
R7256:Ryr3 UTSW 2 112672246 nonsense probably null
R7293:Ryr3 UTSW 2 112902603 missense probably benign 0.13
R7331:Ryr3 UTSW 2 112763665 missense possibly damaging 0.80
R7380:Ryr3 UTSW 2 112640157 missense probably damaging 1.00
R7391:Ryr3 UTSW 2 112780977 critical splice donor site probably null
R7455:Ryr3 UTSW 2 112728866 missense probably damaging 0.99
R7466:Ryr3 UTSW 2 112926957 missense probably benign 0.40
R7481:Ryr3 UTSW 2 112678093 missense probably benign 0.16
R7481:Ryr3 UTSW 2 112678094 missense possibly damaging 0.95
R7497:Ryr3 UTSW 2 112730473 missense probably benign 0.06
R7502:Ryr3 UTSW 2 112712361 missense probably benign 0.00
R7505:Ryr3 UTSW 2 112712429 missense probably damaging 0.99
R7581:Ryr3 UTSW 2 112753027 missense probably damaging 0.99
R7606:Ryr3 UTSW 2 112645245 nonsense probably null
R7677:Ryr3 UTSW 2 112833900 missense probably benign
R7703:Ryr3 UTSW 2 112859765 missense probably damaging 1.00
R7713:Ryr3 UTSW 2 112635346 missense probably benign 0.12
X0057:Ryr3 UTSW 2 112640159 missense probably damaging 1.00
X0064:Ryr3 UTSW 2 112912302 missense probably benign 0.26
Z1088:Ryr3 UTSW 2 112900916 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCAATGTAGACCTAATGCCTAC -3'
(R):5'- GGAGGATCTACAAGACTCCAAAT -3'

Sequencing Primer
(F):5'- GTTTTGGTGACCCCCAGACATAAAG -3'
(R):5'- TAAGCTCAGCTAAGAGGC -3'
Posted On2019-06-26