Incidental Mutation 'R0588:Lrrc69'
ID55833
Institutional Source Beutler Lab
Gene Symbol Lrrc69
Ensembl Gene ENSMUSG00000023151
Gene Nameleucine rich repeat containing 69
Synonyms
MMRRC Submission 038778-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0588 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location14623620-14796060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14704001 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 273 (I273T)
Ref Sequence ENSEMBL: ENSMUSP00000103911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023917] [ENSMUST00000108276]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023917
AA Change: I273T

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023917
Gene: ENSMUSG00000023151
AA Change: I273T

DomainStartEndE-ValueType
LRR 36 58 4.57e0 SMART
LRR 59 81 2.82e0 SMART
LRR 82 105 7.55e-1 SMART
LRR 106 128 7.79e0 SMART
LRR 129 151 1.99e0 SMART
LRR 152 174 5.72e0 SMART
LRR 175 197 3.86e0 SMART
LRR 198 220 8.24e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108276
AA Change: I273T

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103911
Gene: ENSMUSG00000023151
AA Change: I273T

DomainStartEndE-ValueType
LRR 36 58 4.57e0 SMART
LRR 59 81 2.82e0 SMART
LRR 82 105 7.55e-1 SMART
LRR 106 128 7.79e0 SMART
LRR 129 151 1.99e0 SMART
LRR 152 174 5.72e0 SMART
LRR 175 197 3.86e0 SMART
LRR 198 220 8.24e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143565
Meta Mutation Damage Score 0.7109 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (25/25)
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,603,061 K1299* probably null Het
Adamts2 G T 11: 50,776,664 W476C probably damaging Het
Ankrd13c T C 3: 158,005,817 F525L probably damaging Het
Arg1 T C 10: 24,920,624 S102G probably damaging Het
Atp2a3 A T 11: 72,973,024 D192V possibly damaging Het
Cabin1 T C 10: 75,745,337 E385G possibly damaging Het
Cacna1h A T 17: 25,387,564 D1020E probably damaging Het
Calcb C T 7: 114,720,126 H48Y probably benign Het
Crtc1 A G 8: 70,439,549 S4P probably damaging Het
Dcaf6 A G 1: 165,420,223 I147T possibly damaging Het
Ears2 T C 7: 122,044,291 probably benign Het
Fas T C 19: 34,327,140 V267A probably damaging Het
Fus T C 7: 127,985,574 L84P probably damaging Het
Fyb T C 15: 6,580,459 V171A probably benign Het
Gdap2 T A 3: 100,170,001 M1K probably null Het
Gprc5b T A 7: 118,983,995 Q217L probably benign Het
Map4k4 C A 1: 40,004,864 Q556K possibly damaging Het
Npy6r T A 18: 44,275,821 V103E possibly damaging Het
Olfr1449 A G 19: 12,934,747 Y3C probably benign Het
Shisa9 A G 16: 12,267,774 T416A probably damaging Het
Slc26a9 C A 1: 131,754,011 probably benign Het
Sostdc1 G T 12: 36,317,021 probably benign Het
St18 T A 1: 6,817,738 F510L probably damaging Het
Zdhhc7 A G 8: 120,083,367 probably benign Het
Other mutations in Lrrc69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Lrrc69 APN 4 14773663 splice site probably benign
IGL01886:Lrrc69 APN 4 14703984 missense probably benign 0.01
IGL03084:Lrrc69 APN 4 14708631 missense probably damaging 1.00
R1664:Lrrc69 UTSW 4 14775079 missense probably damaging 1.00
R1956:Lrrc69 UTSW 4 14665986 missense possibly damaging 0.50
R1984:Lrrc69 UTSW 4 14708669 missense possibly damaging 0.93
R1985:Lrrc69 UTSW 4 14708669 missense possibly damaging 0.93
R1986:Lrrc69 UTSW 4 14708669 missense possibly damaging 0.93
R2229:Lrrc69 UTSW 4 14773694 missense probably benign 0.00
R3691:Lrrc69 UTSW 4 14795980 missense possibly damaging 0.94
R5691:Lrrc69 UTSW 4 14769648 missense probably damaging 1.00
R5882:Lrrc69 UTSW 4 14708690 missense probably damaging 1.00
R6113:Lrrc69 UTSW 4 14708673 missense probably benign 0.00
R7228:Lrrc69 UTSW 4 14775027 missense probably damaging 1.00
R7880:Lrrc69 UTSW 4 14703946 missense possibly damaging 0.90
R8047:Lrrc69 UTSW 4 14773726 missense probably benign 0.07
R8375:Lrrc69 UTSW 4 14795994 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- CAAAAGGTCTGTGCTGCCATGC -3'
(R):5'- TGGCCCCTGCTTATTGTACTGAGAG -3'

Sequencing Primer
(F):5'- ATCCTATCAACGAATCTATCCTTGG -3'
(R):5'- GCCACATGCAAGTCATGTATAAGTC -3'
Posted On2013-07-11