Incidental Mutation 'R7172:Hoxa5'
ID558340
Institutional Source Beutler Lab
Gene Symbol Hoxa5
Ensembl Gene ENSMUSG00000038253
Gene Namehomeobox A5
SynonymsHox-1.3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.554) question?
Stock #R7172 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location52201754-52204587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52204296 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 19 (Y19H)
Ref Sequence ENSEMBL: ENSMUSP00000039012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048794] [ENSMUST00000062829] [ENSMUST00000114434] [ENSMUST00000128102]
Predicted Effect probably damaging
Transcript: ENSMUST00000048794
AA Change: Y19H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039012
Gene: ENSMUSG00000038253
AA Change: Y19H

DomainStartEndE-ValueType
low complexity region 65 86 N/A INTRINSIC
low complexity region 117 134 N/A INTRINSIC
low complexity region 146 175 N/A INTRINSIC
HOX 195 257 1.63e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062829
SMART Domains Protein: ENSMUSP00000058755
Gene: ENSMUSG00000043219

DomainStartEndE-ValueType
HOX 154 216 2.43e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114434
SMART Domains Protein: ENSMUSP00000110077
Gene: ENSMUSG00000079560

DomainStartEndE-ValueType
low complexity region 76 131 N/A INTRINSIC
HOX 192 254 3.35e-28 SMART
low complexity region 287 302 N/A INTRINSIC
low complexity region 304 326 N/A INTRINSIC
Pfam:DUF4074 377 441 9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128102
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. Methylation of this gene may result in the loss of its expression and, since the encoded protein upregulates the tumor suppressor p53, this protein may play an important role in tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice show skeletal defects, tracheal and lung dysmorphology, reduced surfactant production, emphysema, and partial neonatal lethality. Survivors show stunted growth, delayed ear elevation and eyelid opening, and altered thyroid development, digestive secretion, and ovarian biology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA467197 A T 2: 122,638,318 Y33F probably damaging Het
Abca4 C T 3: 122,103,540 Q623* probably null Het
Abcb1a A T 5: 8,702,399 I457F probably benign Het
Abcb9 G A 5: 124,062,806 Q716* probably null Het
Abhd15 T C 11: 77,515,296 V33A probably benign Het
Abl2 A G 1: 156,622,587 D108G probably damaging Het
Adamts3 G A 5: 89,883,001 probably benign Het
Atmin G T 8: 116,956,542 V314L probably damaging Het
Axl G T 7: 25,786,974 Q102K probably benign Het
B020004J07Rik A G 4: 101,836,996 V230A probably benign Het
Cdhr5 A G 7: 141,271,928 S488P possibly damaging Het
Cnn1 C A 9: 22,105,494 A126D probably damaging Het
Col25a1 A T 3: 130,570,332 K537* probably null Het
Cxcl2 A G 5: 90,904,020 T26A probably benign Het
Dcc T C 18: 71,378,684 T887A probably benign Het
Dhx36 T C 3: 62,501,015 D134G probably benign Het
Dnah17 T A 11: 118,041,131 K3672* probably null Het
Fadd G T 7: 144,582,171 H73Q probably benign Het
Fam35a G A 14: 34,237,568 T819I probably damaging Het
Fancm A G 12: 65,106,054 N1095D possibly damaging Het
Fhod3 T C 18: 25,085,546 S789P probably damaging Het
Glis2 G A 16: 4,613,475 V289I probably benign Het
Gm17728 A C 17: 9,422,388 D110A probably damaging Het
Gm9602 T A 14: 4,777,282 S45T possibly damaging Het
Gpr137 A G 19: 6,939,681 S161P possibly damaging Het
Gpr89 C T 3: 96,880,069 probably null Het
Gps2 C T 11: 69,916,436 T306I probably benign Het
Hmcn1 A G 1: 150,753,699 Y936H possibly damaging Het
Ifit2 G T 19: 34,573,494 A145S probably benign Het
Impdh2 G T 9: 108,560,610 C26F probably benign Het
Kcnh6 T C 11: 106,020,274 Y552H possibly damaging Het
Kcnma1 A T 14: 23,526,623 M254K probably damaging Het
Klhdc9 A T 1: 171,360,660 M1K probably null Het
Klk1b11 A T 7: 43,999,247 D194V possibly damaging Het
Lama1 A G 17: 67,804,545 I2264V Het
Lmntd2 A G 7: 141,213,641 S111P unknown Het
Megf8 T C 7: 25,343,667 L1338P probably damaging Het
Mipol1 G A 12: 57,325,535 E127K possibly damaging Het
Mmp25 A T 17: 23,644,788 C23S probably benign Het
Mup8 A T 4: 60,222,425 C15* probably null Het
Myh2 A T 11: 67,188,701 T995S probably benign Het
Myo1d C T 11: 80,592,795 V863I probably benign Het
N4bp1 A G 8: 86,860,424 probably null Het
Nat10 G T 2: 103,732,969 P562T probably damaging Het
Nedd9 C G 13: 41,316,804 R291P probably benign Het
Nlrc3 G T 16: 3,963,753 H613Q probably benign Het
Ntn1 A T 11: 68,385,667 C152S probably damaging Het
Olfr332 T A 11: 58,489,745 I337F unknown Het
Pam A T 1: 97,834,478 D793E probably benign Het
Patz1 T G 11: 3,308,032 V631G probably benign Het
Pcdh15 G A 10: 74,502,765 V1068M probably damaging Het
Prmt5 A G 14: 54,514,886 F151S possibly damaging Het
Pygo2 G A 3: 89,432,636 V114I probably benign Het
Rabgap1l A T 1: 160,733,586 S220R probably benign Het
Rdh7 T G 10: 127,888,349 S89R possibly damaging Het
Rgsl1 A C 1: 153,826,220 W163G possibly damaging Het
Ryr3 T A 2: 112,661,657 N3783I probably damaging Het
Slit1 A G 19: 41,634,666 L644P probably damaging Het
Steap2 A G 5: 5,682,896 S43P possibly damaging Het
Susd1 A T 4: 59,315,420 probably null Het
Tbc1d9 A G 8: 83,254,761 M686V probably damaging Het
Tdrp G A 8: 13,974,579 R22* probably null Het
Tmem245 A G 4: 56,903,946 V598A possibly damaging Het
Tnxb A G 17: 34,696,020 E1994G probably damaging Het
Trcg1 T A 9: 57,248,335 V757E probably benign Het
Trim10 A G 17: 36,870,063 E62G possibly damaging Het
Ushbp1 G T 8: 71,388,766 A473E possibly damaging Het
Vmn1r50 A C 6: 90,107,404 K44Q possibly damaging Het
Wdr75 A G 1: 45,799,134 N68D probably damaging Het
Wdr83 A G 8: 85,079,824 V115A probably damaging Het
Zdhhc17 A G 10: 111,009,948 L28P possibly damaging Het
Zfp738 C T 13: 67,670,408 C488Y probably damaging Het
Zfp987 T G 4: 146,122,002 L50W probably damaging Het
Zfyve28 G T 5: 34,234,409 R133S probably benign Het
Zscan20 G T 4: 128,585,676 C1007* probably null Het
Other mutations in Hoxa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Hoxa5 APN 6 52204331 missense probably damaging 1.00
IGL01885:Hoxa5 APN 6 52202667 missense probably damaging 1.00
IGL02021:Hoxa5 APN 6 52202657 missense probably damaging 1.00
IGL02631:Hoxa5 APN 6 52203810 missense probably damaging 1.00
IGL02885:Hoxa5 APN 6 52202708 missense probably damaging 1.00
R0377:Hoxa5 UTSW 6 52202646 missense probably damaging 1.00
R0543:Hoxa5 UTSW 6 52204340 missense probably damaging 1.00
R1061:Hoxa5 UTSW 6 52204155 missense probably benign
R1460:Hoxa5 UTSW 6 52203948 missense probably benign 0.00
R1465:Hoxa5 UTSW 6 52203791 missense probably benign 0.37
R1465:Hoxa5 UTSW 6 52203791 missense probably benign 0.37
R1804:Hoxa5 UTSW 6 52202648 missense probably damaging 1.00
R1822:Hoxa5 UTSW 6 52202732 missense probably damaging 1.00
R2332:Hoxa5 UTSW 6 52202679 missense probably damaging 1.00
R4303:Hoxa5 UTSW 6 52204260 missense probably benign 0.01
R4796:Hoxa5 UTSW 6 52203963 missense probably benign 0.01
R5642:Hoxa5 UTSW 6 52204217 missense probably damaging 1.00
R6212:Hoxa5 UTSW 6 52202714 missense probably damaging 1.00
R7134:Hoxa5 UTSW 6 52204043 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTGACTAATGTGCAGCTTG -3'
(R):5'- GAACCGAGTACATGTCCCAG -3'

Sequencing Primer
(F):5'- TTGCGCATCCAGGGGTAGATC -3'
(R):5'- ACCGAGTACATGTCCCAGTCATTTC -3'
Posted On2019-06-26