Incidental Mutation 'R0588:Calcb'
ID55835
Institutional Source Beutler Lab
Gene Symbol Calcb
Ensembl Gene ENSMUSG00000030666
Gene Namecalcitonin-related polypeptide, beta
SynonymsCalc2, CGRP2
MMRRC Submission 038778-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0588 (G1)
Quality Score102
Status Validated
Chromosome7
Chromosomal Location114718643-114723365 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 114720126 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 48 (H48Y)
Ref Sequence ENSEMBL: ENSMUSP00000138713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032902] [ENSMUST00000182044] [ENSMUST00000182816]
Predicted Effect probably benign
Transcript: ENSMUST00000032902
AA Change: H48Y

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000032902
Gene: ENSMUSG00000030666
AA Change: H48Y

DomainStartEndE-ValueType
CALCITONIN 82 124 3.42e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182044
AA Change: H48Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138590
Gene: ENSMUSG00000030666
AA Change: H48Y

DomainStartEndE-ValueType
Pfam:Calc_CGRP_IAPP 1 52 6.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182816
AA Change: H48Y

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000138713
Gene: ENSMUSG00000030666
AA Change: H48Y

DomainStartEndE-ValueType
CALCITONIN 108 150 3.42e-18 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (25/25)
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,603,061 K1299* probably null Het
Adamts2 G T 11: 50,776,664 W476C probably damaging Het
Ankrd13c T C 3: 158,005,817 F525L probably damaging Het
Arg1 T C 10: 24,920,624 S102G probably damaging Het
Atp2a3 A T 11: 72,973,024 D192V possibly damaging Het
Cabin1 T C 10: 75,745,337 E385G possibly damaging Het
Cacna1h A T 17: 25,387,564 D1020E probably damaging Het
Crtc1 A G 8: 70,439,549 S4P probably damaging Het
Dcaf6 A G 1: 165,420,223 I147T possibly damaging Het
Ears2 T C 7: 122,044,291 probably benign Het
Fas T C 19: 34,327,140 V267A probably damaging Het
Fus T C 7: 127,985,574 L84P probably damaging Het
Fyb T C 15: 6,580,459 V171A probably benign Het
Gdap2 T A 3: 100,170,001 M1K probably null Het
Gprc5b T A 7: 118,983,995 Q217L probably benign Het
Lrrc69 A G 4: 14,704,001 I273T possibly damaging Het
Map4k4 C A 1: 40,004,864 Q556K possibly damaging Het
Npy6r T A 18: 44,275,821 V103E possibly damaging Het
Olfr1449 A G 19: 12,934,747 Y3C probably benign Het
Shisa9 A G 16: 12,267,774 T416A probably damaging Het
Slc26a9 C A 1: 131,754,011 probably benign Het
Sostdc1 G T 12: 36,317,021 probably benign Het
St18 T A 1: 6,817,738 F510L probably damaging Het
Zdhhc7 A G 8: 120,083,367 probably benign Het
Other mutations in Calcb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03149:Calcb APN 7 114720136 missense probably damaging 1.00
R3431:Calcb UTSW 7 114719829 missense probably damaging 1.00
R6387:Calcb UTSW 7 114719790 missense possibly damaging 0.74
Z1177:Calcb UTSW 7 114722162 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGGAACTGGCCTAATGACCAGAC -3'
(R):5'- TGATGTTTCCCCATCAGTGCAATCC -3'

Sequencing Primer
(F):5'- TAATGACCAGACCGCTACG -3'
(R):5'- TGTGTCTAACAACTATGAGCCC -3'
Posted On2013-07-11