Incidental Mutation 'R0588:Gprc5b'
List |< first << previous [record 16 of 25] next >> last >|
ID55836
Institutional Source Beutler Lab
Gene Symbol Gprc5b
Ensembl Gene ENSMUSG00000008734
Gene NameG protein-coupled receptor, family C, group 5, member B
Synonymshypothetical protein, clone 2-63
MMRRC Submission 038778-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.409) question?
Stock #R0588 (G1)
Quality Score163
Status Validated
Chromosome7
Chromosomal Location118972047-118995211 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118983995 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 217 (Q217L)
Ref Sequence ENSEMBL: ENSMUSP00000146777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008878] [ENSMUST00000208394]
Predicted Effect probably benign
Transcript: ENSMUST00000008878
AA Change: Q217L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000008878
Gene: ENSMUSG00000008734
AA Change: Q217L

DomainStartEndE-ValueType
Pfam:7tm_3 67 294 2e-33 PFAM
low complexity region 360 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208394
AA Change: Q217L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (25/25)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The encoded protein may modulate insulin secretion and increased protein expression is associated with type 2 diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a reporter allele exhibit partial neonatal and postnatal lethality, altered spontaneous activity pattern, and decreased response to a new environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,603,061 K1299* probably null Het
Adamts2 G T 11: 50,776,664 W476C probably damaging Het
Ankrd13c T C 3: 158,005,817 F525L probably damaging Het
Arg1 T C 10: 24,920,624 S102G probably damaging Het
Atp2a3 A T 11: 72,973,024 D192V possibly damaging Het
Cabin1 T C 10: 75,745,337 E385G possibly damaging Het
Cacna1h A T 17: 25,387,564 D1020E probably damaging Het
Calcb C T 7: 114,720,126 H48Y probably benign Het
Crtc1 A G 8: 70,439,549 S4P probably damaging Het
Dcaf6 A G 1: 165,420,223 I147T possibly damaging Het
Ears2 T C 7: 122,044,291 probably benign Het
Fas T C 19: 34,327,140 V267A probably damaging Het
Fus T C 7: 127,985,574 L84P probably damaging Het
Fyb T C 15: 6,580,459 V171A probably benign Het
Gdap2 T A 3: 100,170,001 M1K probably null Het
Lrrc69 A G 4: 14,704,001 I273T possibly damaging Het
Map4k4 C A 1: 40,004,864 Q556K possibly damaging Het
Npy6r T A 18: 44,275,821 V103E possibly damaging Het
Olfr1449 A G 19: 12,934,747 Y3C probably benign Het
Shisa9 A G 16: 12,267,774 T416A probably damaging Het
Slc26a9 C A 1: 131,754,011 probably benign Het
Sostdc1 G T 12: 36,317,021 probably benign Het
St18 T A 1: 6,817,738 F510L probably damaging Het
Zdhhc7 A G 8: 120,083,367 probably benign Het
Other mutations in Gprc5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Gprc5b APN 7 118983861 missense probably benign
IGL01687:Gprc5b APN 7 118983986 missense possibly damaging 0.67
IGL02937:Gprc5b APN 7 118983794 missense probably benign 0.36
IGL03088:Gprc5b APN 7 118983633 missense probably benign 0.08
IGL03106:Gprc5b APN 7 118984193 missense probably damaging 1.00
IGL03166:Gprc5b APN 7 118983999 missense probably benign 0.20
R0189:Gprc5b UTSW 7 118983633 missense probably benign 0.08
R1563:Gprc5b UTSW 7 118983761 missense probably benign 0.22
R2126:Gprc5b UTSW 7 118984175 missense probably damaging 1.00
R2842:Gprc5b UTSW 7 118984079 missense possibly damaging 0.93
R3153:Gprc5b UTSW 7 118976547 missense probably damaging 1.00
R3802:Gprc5b UTSW 7 118983720 missense possibly damaging 0.92
R3978:Gprc5b UTSW 7 118984131 missense probably damaging 1.00
R4007:Gprc5b UTSW 7 118984214 missense possibly damaging 0.55
R4183:Gprc5b UTSW 7 118984526 missense probably benign 0.03
R4297:Gprc5b UTSW 7 118984214 missense possibly damaging 0.55
R4298:Gprc5b UTSW 7 118984214 missense possibly damaging 0.55
R4299:Gprc5b UTSW 7 118984214 missense possibly damaging 0.55
R5286:Gprc5b UTSW 7 118983687 missense possibly damaging 0.93
R6492:Gprc5b UTSW 7 118984577 missense possibly damaging 0.68
R6606:Gprc5b UTSW 7 118984073 missense probably benign 0.00
R7085:Gprc5b UTSW 7 118983632 missense probably damaging 0.97
R7312:Gprc5b UTSW 7 118984259 missense probably damaging 1.00
R7593:Gprc5b UTSW 7 118984269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTGGGCTGTGAAGTGTCGAAG -3'
(R):5'- TGGACGAGACAATCTGCTCCATCC -3'

Sequencing Primer
(F):5'- AGAAGGGTGTAGTGGATCTCC -3'
(R):5'- AATCTGCTCCATCCGACGC -3'
Posted On2013-07-11