Mutagenetix > Incidental Mutations

Incidental Mutation 'R7172:Patz1'

558360

Institutional Source

Beutler Lab

Gene Symbol

Patz1

Ensembl Gene

ENSMUSG00000020453

Gene Name

POZ (BTB) and AT hook containing zinc finger 1

Synonyms

MAZR, POZ-AT hook-zinc finger protein, 8430401L15Rik, Zfp278

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.876) question?

Stock #

R7172 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3288874-3309083 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 3308032 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 631 (V631G)

Ref Sequence

ENSEMBL: ENSMUSP00000050684 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057089] [ENSMUST00000093402] [ENSMUST00000110043] [ENSMUST00000134089] [ENSMUST00000154319]

Predicted Effect

probably benign
Transcript: ENSMUST00000057089
AA Change: V631G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000050684
Gene: ENSMUSG00000020453
AA Change: V631G

Domain	Start	End	E-Value	Type
BTB	41	160	7.97e-24	SMART
low complexity region	209	224	N/A	INTRINSIC
AT_hook	264	276	1.74e-1	SMART
ZnF_C2H2	292	314	1.18e-2	SMART
AT_hook	345	357	2.82e2	SMART
ZnF_C2H2	355	377	8.94e-3	SMART
ZnF_C2H2	383	405	5.21e-4	SMART
ZnF_C2H2	413	436	3.39e-3	SMART
ZnF_C2H2	442	464	1.45e-2	SMART
ZnF_C2H2	468	489	2.01e1	SMART
ZnF_C2H2	559	582	1.98e-4	SMART
low complexity region	585	598	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000093402

SMART Domains

Protein: ENSMUSP00000091103
Gene: ENSMUSG00000020453

Domain	Start	End	E-Value	Type
BTB	41	160	7.97e-24	SMART
low complexity region	209	224	N/A	INTRINSIC
AT_hook	264	276	1.74e-1	SMART
ZnF_C2H2	292	314	1.18e-2	SMART
AT_hook	345	357	2.82e2	SMART
ZnF_C2H2	355	377	8.94e-3	SMART
ZnF_C2H2	383	405	5.21e-4	SMART
ZnF_C2H2	413	436	3.39e-3	SMART
ZnF_C2H2	442	464	1.45e-2	SMART
ZnF_C2H2	468	489	2.01e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110043
AA Change: V677G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000105670
Gene: ENSMUSG00000020453
AA Change: V677G

Domain	Start	End	E-Value	Type
BTB	41	160	7.97e-24	SMART
low complexity region	209	224	N/A	INTRINSIC
AT_hook	264	276	1.74e-1	SMART
ZnF_C2H2	292	314	1.18e-2	SMART
AT_hook	345	357	2.82e2	SMART
ZnF_C2H2	355	377	8.94e-3	SMART
ZnF_C2H2	383	405	5.21e-4	SMART
ZnF_C2H2	413	436	3.39e-3	SMART
ZnF_C2H2	442	464	1.45e-2	SMART
ZnF_C2H2	468	489	2.01e1	SMART
ZnF_C2H2	495	517	1.26e-2	SMART
Pfam:zf-C2H2_assoc3	536	604	6.5e-36	PFAM
ZnF_C2H2	605	628	1.98e-4	SMART
low complexity region	631	644	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000134089

SMART Domains

Protein: ENSMUSP00000138522
Gene: ENSMUSG00000020453

Domain	Start	End	E-Value	Type
ZnF_C2H2	5	29	2.82e0	SMART
ZnF_C2H2	33	54	2.01e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000154319

SMART Domains

Protein: ENSMUSP00000122832
Gene: ENSMUSG00000020453

Domain	Start	End	E-Value	Type
ZnF_C2H2	6	25	5.68e1	SMART
ZnF_C2H2	29	50	2.01e1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an A-T hook DNA binding motif which usually binds to other DNA binding structures to play an important role in chromatin modeling and transcription regulation. Its Poz domain is thought to function as a site for protein-protein interaction and is required for transcriptional repression, and the zinc-fingers comprise the DNA binding domain. Since the encoded protein has typical features of a transcription factor, it is postulated to be a repressor of gene expression. In small round cell sarcoma, this gene is fused to EWS by a small inversion of 22q, then the hybrid is thought to be translocated (t(1;22)(p36.1;q12). The rearrangement of chromosome 22 involves intron 8 of EWS and exon 1 of this gene creating a chimeric sequence containing the transactivation domain of EWS fused to zinc finger domain of this protein. This is a distinct example of an intra-chromosomal rearrangement of chromosome 22. Four alternatively spliced transcript variants are described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some embryonic and fetal lethality, exencephaly, nervous system defects, outflow defects, transposition of great arteries, postnatal growth retardation and male and female infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA467197	A	T	2: 122,638,318	Y33F	probably damaging	Het
Abca4	C	T	3: 122,103,540	Q623*	probably null	Het
Abcb1a	A	T	5: 8,702,399	I457F	probably benign	Het
Abcb9	G	A	5: 124,062,806	Q716*	probably null	Het
Abhd15	T	C	11: 77,515,296	V33A	probably benign	Het
Abl2	A	G	1: 156,622,587	D108G	probably damaging	Het
Adamts3	G	A	5: 89,883,001		probably benign	Het
Atmin	G	T	8: 116,956,542	V314L	probably damaging	Het
Axl	G	T	7: 25,786,974	Q102K	probably benign	Het
B020004J07Rik	A	G	4: 101,836,996	V230A	probably benign	Het
Cdhr5	A	G	7: 141,271,928	S488P	possibly damaging	Het
Cnn1	C	A	9: 22,105,494	A126D	probably damaging	Het
Col25a1	A	T	3: 130,570,332	K537*	probably null	Het
Cxcl2	A	G	5: 90,904,020	T26A	probably benign	Het
Dcc	T	C	18: 71,378,684	T887A	probably benign	Het
Dhx36	T	C	3: 62,501,015	D134G	probably benign	Het
Dnah17	T	A	11: 118,041,131	K3672*	probably null	Het
Fadd	G	T	7: 144,582,171	H73Q	probably benign	Het
Fam35a	G	A	14: 34,237,568	T819I	probably damaging	Het
Fancm	A	G	12: 65,106,054	N1095D	possibly damaging	Het
Fhod3	T	C	18: 25,085,546	S789P	probably damaging	Het
Glis2	G	A	16: 4,613,475	V289I	probably benign	Het
Gm17728	A	C	17: 9,422,388	D110A	probably damaging	Het
Gm9602	T	A	14: 4,777,282	S45T	possibly damaging	Het
Gpr137	A	G	19: 6,939,681	S161P	possibly damaging	Het
Gpr89	C	T	3: 96,880,069		probably null	Het
Gps2	C	T	11: 69,916,436	T306I	probably benign	Het
Hmcn1	A	G	1: 150,753,699	Y936H	possibly damaging	Het
Hoxa5	A	G	6: 52,204,296	Y19H	probably damaging	Het
Ifit2	G	T	19: 34,573,494	A145S	probably benign	Het
Impdh2	G	T	9: 108,560,610	C26F	probably benign	Het
Kcnh6	T	C	11: 106,020,274	Y552H	possibly damaging	Het
Kcnma1	A	T	14: 23,526,623	M254K	probably damaging	Het
Klhdc9	A	T	1: 171,360,660	M1K	probably null	Het
Klk1b11	A	T	7: 43,999,247	D194V	possibly damaging	Het
Lama1	A	G	17: 67,804,545	I2264V		Het
Lmntd2	A	G	7: 141,213,641	S111P	unknown	Het
Megf8	T	C	7: 25,343,667	L1338P	probably damaging	Het
Mipol1	G	A	12: 57,325,535	E127K	possibly damaging	Het
Mmp25	A	T	17: 23,644,788	C23S	probably benign	Het
Mup8	A	T	4: 60,222,425	C15*	probably null	Het
Myh2	A	T	11: 67,188,701	T995S	probably benign	Het
Myo1d	C	T	11: 80,592,795	V863I	probably benign	Het
N4bp1	A	G	8: 86,860,424		probably null	Het
Nat10	G	T	2: 103,732,969	P562T	probably damaging	Het
Nedd9	C	G	13: 41,316,804	R291P	probably benign	Het
Nlrc3	G	T	16: 3,963,753	H613Q	probably benign	Het
Ntn1	A	T	11: 68,385,667	C152S	probably damaging	Het
Olfr332	T	A	11: 58,489,745	I337F	unknown	Het
Pam	A	T	1: 97,834,478	D793E	probably benign	Het
Pcdh15	G	A	10: 74,502,765	V1068M	probably damaging	Het
Prmt5	A	G	14: 54,514,886	F151S	possibly damaging	Het
Pygo2	G	A	3: 89,432,636	V114I	probably benign	Het
Rabgap1l	A	T	1: 160,733,586	S220R	probably benign	Het
Rdh7	T	G	10: 127,888,349	S89R	possibly damaging	Het
Rgsl1	A	C	1: 153,826,220	W163G	possibly damaging	Het
Ryr3	T	A	2: 112,661,657	N3783I	probably damaging	Het
Slit1	A	G	19: 41,634,666	L644P	probably damaging	Het
Steap2	A	G	5: 5,682,896	S43P	possibly damaging	Het
Susd1	A	T	4: 59,315,420		probably null	Het
Tbc1d9	A	G	8: 83,254,761	M686V	probably damaging	Het
Tdrp	G	A	8: 13,974,579	R22*	probably null	Het
Tmem245	A	G	4: 56,903,946	V598A	possibly damaging	Het
Tnxb	A	G	17: 34,696,020	E1994G	probably damaging	Het
Trcg1	T	A	9: 57,248,335	V757E	probably benign	Het
Trim10	A	G	17: 36,870,063	E62G	possibly damaging	Het
Ushbp1	G	T	8: 71,388,766	A473E	possibly damaging	Het
Vmn1r50	A	C	6: 90,107,404	K44Q	possibly damaging	Het
Wdr75	A	G	1: 45,799,134	N68D	probably damaging	Het
Wdr83	A	G	8: 85,079,824	V115A	probably damaging	Het
Zdhhc17	A	G	10: 111,009,948	L28P	possibly damaging	Het
Zfp738	C	T	13: 67,670,408	C488Y	probably damaging	Het
Zfp987	T	G	4: 146,122,002	L50W	probably damaging	Het
Zfyve28	G	T	5: 34,234,409	R133S	probably benign	Het
Zscan20	G	T	4: 128,585,676	C1007*	probably null	Het

Other mutations in Patz1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02187:Patz1	APN	11	3291134	missense	probably damaging	1.00
IGL02954:Patz1	APN	11	3291761	missense	probably damaging	1.00
IGL02981:Patz1	APN	11	3290656	missense	probably damaging	1.00
R0153:Patz1	UTSW	11	3293288	missense	probably damaging	1.00
R0758:Patz1	UTSW	11	3290879	missense	probably damaging	1.00
R1680:Patz1	UTSW	11	3307812	missense	probably damaging	0.96
R1954:Patz1	UTSW	11	3291088	missense	probably damaging	0.99
R4610:Patz1	UTSW	11	3306241	missense	probably damaging	1.00
R4964:Patz1	UTSW	11	3307720	missense	probably damaging	1.00
R5832:Patz1	UTSW	11	3306277	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGGAGCTTCTTCCGTTCTAAGTC -3'
(R):5'- TTCTAAGACCACAGCAGGTG -3'

Sequencing Primer
(F):5'- CGTTCTAAGTCCTACTTGAACAAAC -3'
(R):5'- CACAGCAGGTGGGGTTAATG -3'

Posted On

2019-06-26