Incidental Mutation 'R7172:Patz1'
ID558360
Institutional Source Beutler Lab
Gene Symbol Patz1
Ensembl Gene ENSMUSG00000020453
Gene NamePOZ (BTB) and AT hook containing zinc finger 1
SynonymsMAZR, POZ-AT hook-zinc finger protein, 8430401L15Rik, Zfp278
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.876) question?
Stock #R7172 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location3288874-3309083 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 3308032 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 631 (V631G)
Ref Sequence ENSEMBL: ENSMUSP00000050684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057089] [ENSMUST00000093402] [ENSMUST00000110043] [ENSMUST00000134089] [ENSMUST00000154319]
Predicted Effect probably benign
Transcript: ENSMUST00000057089
AA Change: V631G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050684
Gene: ENSMUSG00000020453
AA Change: V631G

DomainStartEndE-ValueType
BTB 41 160 7.97e-24 SMART
low complexity region 209 224 N/A INTRINSIC
AT_hook 264 276 1.74e-1 SMART
ZnF_C2H2 292 314 1.18e-2 SMART
AT_hook 345 357 2.82e2 SMART
ZnF_C2H2 355 377 8.94e-3 SMART
ZnF_C2H2 383 405 5.21e-4 SMART
ZnF_C2H2 413 436 3.39e-3 SMART
ZnF_C2H2 442 464 1.45e-2 SMART
ZnF_C2H2 468 489 2.01e1 SMART
ZnF_C2H2 559 582 1.98e-4 SMART
low complexity region 585 598 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093402
SMART Domains Protein: ENSMUSP00000091103
Gene: ENSMUSG00000020453

DomainStartEndE-ValueType
BTB 41 160 7.97e-24 SMART
low complexity region 209 224 N/A INTRINSIC
AT_hook 264 276 1.74e-1 SMART
ZnF_C2H2 292 314 1.18e-2 SMART
AT_hook 345 357 2.82e2 SMART
ZnF_C2H2 355 377 8.94e-3 SMART
ZnF_C2H2 383 405 5.21e-4 SMART
ZnF_C2H2 413 436 3.39e-3 SMART
ZnF_C2H2 442 464 1.45e-2 SMART
ZnF_C2H2 468 489 2.01e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110043
AA Change: V677G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000105670
Gene: ENSMUSG00000020453
AA Change: V677G

DomainStartEndE-ValueType
BTB 41 160 7.97e-24 SMART
low complexity region 209 224 N/A INTRINSIC
AT_hook 264 276 1.74e-1 SMART
ZnF_C2H2 292 314 1.18e-2 SMART
AT_hook 345 357 2.82e2 SMART
ZnF_C2H2 355 377 8.94e-3 SMART
ZnF_C2H2 383 405 5.21e-4 SMART
ZnF_C2H2 413 436 3.39e-3 SMART
ZnF_C2H2 442 464 1.45e-2 SMART
ZnF_C2H2 468 489 2.01e1 SMART
ZnF_C2H2 495 517 1.26e-2 SMART
Pfam:zf-C2H2_assoc3 536 604 6.5e-36 PFAM
ZnF_C2H2 605 628 1.98e-4 SMART
low complexity region 631 644 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134089
SMART Domains Protein: ENSMUSP00000138522
Gene: ENSMUSG00000020453

DomainStartEndE-ValueType
ZnF_C2H2 5 29 2.82e0 SMART
ZnF_C2H2 33 54 2.01e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154319
SMART Domains Protein: ENSMUSP00000122832
Gene: ENSMUSG00000020453

DomainStartEndE-ValueType
ZnF_C2H2 6 25 5.68e1 SMART
ZnF_C2H2 29 50 2.01e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an A-T hook DNA binding motif which usually binds to other DNA binding structures to play an important role in chromatin modeling and transcription regulation. Its Poz domain is thought to function as a site for protein-protein interaction and is required for transcriptional repression, and the zinc-fingers comprise the DNA binding domain. Since the encoded protein has typical features of a transcription factor, it is postulated to be a repressor of gene expression. In small round cell sarcoma, this gene is fused to EWS by a small inversion of 22q, then the hybrid is thought to be translocated (t(1;22)(p36.1;q12). The rearrangement of chromosome 22 involves intron 8 of EWS and exon 1 of this gene creating a chimeric sequence containing the transactivation domain of EWS fused to zinc finger domain of this protein. This is a distinct example of an intra-chromosomal rearrangement of chromosome 22. Four alternatively spliced transcript variants are described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some embryonic and fetal lethality, exencephaly, nervous system defects, outflow defects, transposition of great arteries, postnatal growth retardation and male and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA467197 A T 2: 122,638,318 Y33F probably damaging Het
Abca4 C T 3: 122,103,540 Q623* probably null Het
Abcb1a A T 5: 8,702,399 I457F probably benign Het
Abcb9 G A 5: 124,062,806 Q716* probably null Het
Abhd15 T C 11: 77,515,296 V33A probably benign Het
Abl2 A G 1: 156,622,587 D108G probably damaging Het
Adamts3 G A 5: 89,883,001 probably benign Het
Atmin G T 8: 116,956,542 V314L probably damaging Het
Axl G T 7: 25,786,974 Q102K probably benign Het
B020004J07Rik A G 4: 101,836,996 V230A probably benign Het
Cdhr5 A G 7: 141,271,928 S488P possibly damaging Het
Cnn1 C A 9: 22,105,494 A126D probably damaging Het
Col25a1 A T 3: 130,570,332 K537* probably null Het
Cxcl2 A G 5: 90,904,020 T26A probably benign Het
Dcc T C 18: 71,378,684 T887A probably benign Het
Dhx36 T C 3: 62,501,015 D134G probably benign Het
Dnah17 T A 11: 118,041,131 K3672* probably null Het
Fadd G T 7: 144,582,171 H73Q probably benign Het
Fam35a G A 14: 34,237,568 T819I probably damaging Het
Fancm A G 12: 65,106,054 N1095D possibly damaging Het
Fhod3 T C 18: 25,085,546 S789P probably damaging Het
Glis2 G A 16: 4,613,475 V289I probably benign Het
Gm17728 A C 17: 9,422,388 D110A probably damaging Het
Gm9602 T A 14: 4,777,282 S45T possibly damaging Het
Gpr137 A G 19: 6,939,681 S161P possibly damaging Het
Gpr89 C T 3: 96,880,069 probably null Het
Gps2 C T 11: 69,916,436 T306I probably benign Het
Hmcn1 A G 1: 150,753,699 Y936H possibly damaging Het
Hoxa5 A G 6: 52,204,296 Y19H probably damaging Het
Ifit2 G T 19: 34,573,494 A145S probably benign Het
Impdh2 G T 9: 108,560,610 C26F probably benign Het
Kcnh6 T C 11: 106,020,274 Y552H possibly damaging Het
Kcnma1 A T 14: 23,526,623 M254K probably damaging Het
Klhdc9 A T 1: 171,360,660 M1K probably null Het
Klk1b11 A T 7: 43,999,247 D194V possibly damaging Het
Lama1 A G 17: 67,804,545 I2264V Het
Lmntd2 A G 7: 141,213,641 S111P unknown Het
Megf8 T C 7: 25,343,667 L1338P probably damaging Het
Mipol1 G A 12: 57,325,535 E127K possibly damaging Het
Mmp25 A T 17: 23,644,788 C23S probably benign Het
Mup8 A T 4: 60,222,425 C15* probably null Het
Myh2 A T 11: 67,188,701 T995S probably benign Het
Myo1d C T 11: 80,592,795 V863I probably benign Het
N4bp1 A G 8: 86,860,424 probably null Het
Nat10 G T 2: 103,732,969 P562T probably damaging Het
Nedd9 C G 13: 41,316,804 R291P probably benign Het
Nlrc3 G T 16: 3,963,753 H613Q probably benign Het
Ntn1 A T 11: 68,385,667 C152S probably damaging Het
Olfr332 T A 11: 58,489,745 I337F unknown Het
Pam A T 1: 97,834,478 D793E probably benign Het
Pcdh15 G A 10: 74,502,765 V1068M probably damaging Het
Prmt5 A G 14: 54,514,886 F151S possibly damaging Het
Pygo2 G A 3: 89,432,636 V114I probably benign Het
Rabgap1l A T 1: 160,733,586 S220R probably benign Het
Rdh7 T G 10: 127,888,349 S89R possibly damaging Het
Rgsl1 A C 1: 153,826,220 W163G possibly damaging Het
Ryr3 T A 2: 112,661,657 N3783I probably damaging Het
Slit1 A G 19: 41,634,666 L644P probably damaging Het
Steap2 A G 5: 5,682,896 S43P possibly damaging Het
Susd1 A T 4: 59,315,420 probably null Het
Tbc1d9 A G 8: 83,254,761 M686V probably damaging Het
Tdrp G A 8: 13,974,579 R22* probably null Het
Tmem245 A G 4: 56,903,946 V598A possibly damaging Het
Tnxb A G 17: 34,696,020 E1994G probably damaging Het
Trcg1 T A 9: 57,248,335 V757E probably benign Het
Trim10 A G 17: 36,870,063 E62G possibly damaging Het
Ushbp1 G T 8: 71,388,766 A473E possibly damaging Het
Vmn1r50 A C 6: 90,107,404 K44Q possibly damaging Het
Wdr75 A G 1: 45,799,134 N68D probably damaging Het
Wdr83 A G 8: 85,079,824 V115A probably damaging Het
Zdhhc17 A G 10: 111,009,948 L28P possibly damaging Het
Zfp738 C T 13: 67,670,408 C488Y probably damaging Het
Zfp987 T G 4: 146,122,002 L50W probably damaging Het
Zfyve28 G T 5: 34,234,409 R133S probably benign Het
Zscan20 G T 4: 128,585,676 C1007* probably null Het
Other mutations in Patz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Patz1 APN 11 3291134 missense probably damaging 1.00
IGL02954:Patz1 APN 11 3291761 missense probably damaging 1.00
IGL02981:Patz1 APN 11 3290656 missense probably damaging 1.00
R0153:Patz1 UTSW 11 3293288 missense probably damaging 1.00
R0758:Patz1 UTSW 11 3290879 missense probably damaging 1.00
R1680:Patz1 UTSW 11 3307812 missense probably damaging 0.96
R1954:Patz1 UTSW 11 3291088 missense probably damaging 0.99
R4610:Patz1 UTSW 11 3306241 missense probably damaging 1.00
R4964:Patz1 UTSW 11 3307720 missense probably damaging 1.00
R5832:Patz1 UTSW 11 3306277 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGAGCTTCTTCCGTTCTAAGTC -3'
(R):5'- TTCTAAGACCACAGCAGGTG -3'

Sequencing Primer
(F):5'- CGTTCTAAGTCCTACTTGAACAAAC -3'
(R):5'- CACAGCAGGTGGGGTTAATG -3'
Posted On2019-06-26