Incidental Mutation 'R0588:Ears2'
List |< first << previous [record 11 of 25] next >> last >|
ID55837
Institutional Source Beutler Lab
Gene Symbol Ears2
Ensembl Gene ENSMUSG00000030871
Gene Nameglutamyl-tRNA synthetase 2, mitochondrial
Synonyms3230401I01Rik
MMRRC Submission 038778-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0588 (G1)
Quality Score160
Status Validated
Chromosome7
Chromosomal Location122037213-122067263 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 122044291 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033159]
Predicted Effect probably benign
Transcript: ENSMUST00000033159
SMART Domains Protein: ENSMUSP00000033159
Gene: ENSMUSG00000030871

DomainStartEndE-ValueType
Pfam:tRNA-synt_1c 36 353 3.5e-88 PFAM
low complexity region 448 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147397
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151530
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (25/25)
MGI Phenotype FUNCTION: This gene encodes a putative member of the class I family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of glutamate to tRNA molecules. Mutations in a similar gene in human have been associated with combined oxidative phosphorylation deficiency 12 (COXPD12). [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,603,061 K1299* probably null Het
Adamts2 G T 11: 50,776,664 W476C probably damaging Het
Ankrd13c T C 3: 158,005,817 F525L probably damaging Het
Arg1 T C 10: 24,920,624 S102G probably damaging Het
Atp2a3 A T 11: 72,973,024 D192V possibly damaging Het
Cabin1 T C 10: 75,745,337 E385G possibly damaging Het
Cacna1h A T 17: 25,387,564 D1020E probably damaging Het
Calcb C T 7: 114,720,126 H48Y probably benign Het
Crtc1 A G 8: 70,439,549 S4P probably damaging Het
Dcaf6 A G 1: 165,420,223 I147T possibly damaging Het
Fas T C 19: 34,327,140 V267A probably damaging Het
Fus T C 7: 127,985,574 L84P probably damaging Het
Fyb T C 15: 6,580,459 V171A probably benign Het
Gdap2 T A 3: 100,170,001 M1K probably null Het
Gprc5b T A 7: 118,983,995 Q217L probably benign Het
Lrrc69 A G 4: 14,704,001 I273T possibly damaging Het
Map4k4 C A 1: 40,004,864 Q556K possibly damaging Het
Npy6r T A 18: 44,275,821 V103E possibly damaging Het
Olfr1449 A G 19: 12,934,747 Y3C probably benign Het
Shisa9 A G 16: 12,267,774 T416A probably damaging Het
Slc26a9 C A 1: 131,754,011 probably benign Het
Sostdc1 G T 12: 36,317,021 probably benign Het
St18 T A 1: 6,817,738 F510L probably damaging Het
Zdhhc7 A G 8: 120,083,367 probably benign Het
Other mutations in Ears2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Ears2 APN 7 122039762 nonsense probably null
IGL00870:Ears2 APN 7 122055676 missense probably damaging 1.00
IGL01434:Ears2 APN 7 122063088 splice site probably benign
IGL01676:Ears2 APN 7 122044558 missense probably benign
IGL02341:Ears2 APN 7 122039764 missense probably benign
IGL02355:Ears2 APN 7 122044550 missense probably benign 0.00
IGL02362:Ears2 APN 7 122044550 missense probably benign 0.00
IGL02932:Ears2 APN 7 122063061 missense probably damaging 1.00
PIT4453001:Ears2 UTSW 7 122048339 missense probably benign 0.04
R0555:Ears2 UTSW 7 122048444 missense probably benign 0.22
R0582:Ears2 UTSW 7 122055658 missense probably benign 0.05
R0733:Ears2 UTSW 7 122048129 missense possibly damaging 0.83
R1316:Ears2 UTSW 7 122046682 missense probably benign 0.00
R1916:Ears2 UTSW 7 122044578 missense probably benign 0.01
R2862:Ears2 UTSW 7 122062940 missense probably damaging 1.00
R4634:Ears2 UTSW 7 122044609 missense probably benign 0.00
R4686:Ears2 UTSW 7 122048204 missense probably damaging 1.00
R5177:Ears2 UTSW 7 122044460 intron probably benign
R5275:Ears2 UTSW 7 122048198 missense probably damaging 1.00
R5295:Ears2 UTSW 7 122048198 missense probably damaging 1.00
R5385:Ears2 UTSW 7 122044377 missense probably benign 0.36
R5386:Ears2 UTSW 7 122044377 missense probably benign 0.36
R6510:Ears2 UTSW 7 122062994 missense probably damaging 1.00
R6894:Ears2 UTSW 7 122048224 missense probably damaging 1.00
R7828:Ears2 UTSW 7 122048340 missense probably benign
Z1176:Ears2 UTSW 7 122044581 missense probably damaging 0.98
Z1176:Ears2 UTSW 7 122055710 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CTTCCAAAGCCTGGCTTGCAATAC -3'
(R):5'- AGGGTTTCCCAAGTTCTCAGGGTG -3'

Sequencing Primer
(F):5'- gcaggcaaaacactcatacac -3'
(R):5'- GCATGTGGTGACTGCCTC -3'
Posted On2013-07-11