Incidental Mutation 'R0588:Fus'
List |< first << previous [record 13 of 25] next >> last >|
ID55838
Institutional Source Beutler Lab
Gene Symbol Fus
Ensembl Gene ENSMUSG00000030795
Gene Namefused in sarcoma
SynonymsD430004D17Rik, hnRNP P2, pigpen, D930039C12Rik, translocated in liposarcoma, Tls
MMRRC Submission 038778-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0588 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127967457-127985701 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127985574 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 84 (L84P)
Ref Sequence ENSEMBL: ENSMUSP00000078054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033056] [ENSMUST00000077609] [ENSMUST00000079045] [ENSMUST00000106251] [ENSMUST00000121616]
Predicted Effect probably benign
Transcript: ENSMUST00000033056
SMART Domains Protein: ENSMUSP00000033056
Gene: ENSMUSG00000030793

DomainStartEndE-ValueType
PYRIN 4 87 3.64e-28 SMART
low complexity region 94 107 N/A INTRINSIC
Pfam:CARD 110 193 1.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077609
SMART Domains Protein: ENSMUSP00000076801
Gene: ENSMUSG00000030795

DomainStartEndE-ValueType
low complexity region 20 44 N/A INTRINSIC
low complexity region 48 67 N/A INTRINSIC
low complexity region 72 104 N/A INTRINSIC
low complexity region 110 179 N/A INTRINSIC
low complexity region 185 253 N/A INTRINSIC
RRM 278 359 3.85e-16 SMART
ZnF_RBZ 416 442 9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079045
AA Change: L84P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078054
Gene: ENSMUSG00000030795
AA Change: L84P

DomainStartEndE-ValueType
transmembrane domain 89 111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106251
SMART Domains Protein: ENSMUSP00000101858
Gene: ENSMUSG00000030795

DomainStartEndE-ValueType
low complexity region 20 44 N/A INTRINSIC
low complexity region 47 63 N/A INTRINSIC
low complexity region 73 105 N/A INTRINSIC
low complexity region 111 180 N/A INTRINSIC
low complexity region 186 254 N/A INTRINSIC
RRM 279 360 3.85e-16 SMART
ZnF_RBZ 417 443 9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121616
SMART Domains Protein: ENSMUSP00000112721
Gene: ENSMUSG00000030795

DomainStartEndE-ValueType
low complexity region 20 44 N/A INTRINSIC
low complexity region 47 63 N/A INTRINSIC
low complexity region 73 105 N/A INTRINSIC
low complexity region 111 176 N/A INTRINSIC
ZnF_RBZ 179 205 9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128851
Predicted Effect probably benign
Transcript: ENSMUST00000141997
SMART Domains Protein: ENSMUSP00000134447
Gene: ENSMUSG00000030795

DomainStartEndE-ValueType
ZnF_RBZ 15 41 9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172755
Predicted Effect probably benign
Transcript: ENSMUST00000174632
SMART Domains Protein: ENSMUSP00000133820
Gene: ENSMUSG00000030795

DomainStartEndE-ValueType
Pfam:RRM_1 6 56 6.6e-9 PFAM
ZnF_RBZ 77 103 9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181457
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (25/25)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired lymphocyte development, chromosomal instability, increased cellular radiation sensitivity, high neonatal mortality, and male sterility associated with lack of chromosomal pairing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,603,061 K1299* probably null Het
Adamts2 G T 11: 50,776,664 W476C probably damaging Het
Ankrd13c T C 3: 158,005,817 F525L probably damaging Het
Arg1 T C 10: 24,920,624 S102G probably damaging Het
Atp2a3 A T 11: 72,973,024 D192V possibly damaging Het
Cabin1 T C 10: 75,745,337 E385G possibly damaging Het
Cacna1h A T 17: 25,387,564 D1020E probably damaging Het
Calcb C T 7: 114,720,126 H48Y probably benign Het
Crtc1 A G 8: 70,439,549 S4P probably damaging Het
Dcaf6 A G 1: 165,420,223 I147T possibly damaging Het
Ears2 T C 7: 122,044,291 probably benign Het
Fas T C 19: 34,327,140 V267A probably damaging Het
Fyb T C 15: 6,580,459 V171A probably benign Het
Gdap2 T A 3: 100,170,001 M1K probably null Het
Gprc5b T A 7: 118,983,995 Q217L probably benign Het
Lrrc69 A G 4: 14,704,001 I273T possibly damaging Het
Map4k4 C A 1: 40,004,864 Q556K possibly damaging Het
Npy6r T A 18: 44,275,821 V103E possibly damaging Het
Olfr1449 A G 19: 12,934,747 Y3C probably benign Het
Shisa9 A G 16: 12,267,774 T416A probably damaging Het
Slc26a9 C A 1: 131,754,011 probably benign Het
Sostdc1 G T 12: 36,317,021 probably benign Het
St18 T A 1: 6,817,738 F510L probably damaging Het
Zdhhc7 A G 8: 120,083,367 probably benign Het
Other mutations in Fus
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02505:Fus APN 7 127981507 missense possibly damaging 0.53
IGL02622:Fus APN 7 127985622 missense probably damaging 0.99
IGL02951:Fus APN 7 127981837 unclassified probably benign
IGL03029:Fus APN 7 127985540 unclassified probably benign
R0674:Fus UTSW 7 127972776 unclassified probably benign
R0686:Fus UTSW 7 127972763 unclassified probably benign
R0746:Fus UTSW 7 127985424 unclassified probably benign
R1562:Fus UTSW 7 127979922 missense probably damaging 1.00
R1733:Fus UTSW 7 127981545 missense probably benign 0.01
R2186:Fus UTSW 7 127985534 unclassified probably benign
R2200:Fus UTSW 7 127977228 missense probably damaging 0.99
R4537:Fus UTSW 7 127975915 missense probably damaging 0.99
R4981:Fus UTSW 7 127967555 start gained probably benign
R5206:Fus UTSW 7 127969797 missense unknown
R5283:Fus UTSW 7 127985547 unclassified probably benign
R5614:Fus UTSW 7 127974371 unclassified probably benign
R6182:Fus UTSW 7 127977293 missense probably damaging 0.97
R6239:Fus UTSW 7 127981434 missense possibly damaging 0.91
R6939:Fus UTSW 7 127972569 unclassified probably benign
R7130:Fus UTSW 7 127974413 missense unknown
R7340:Fus UTSW 7 127981951 splice site probably null
R8293:Fus UTSW 7 127972577 missense unknown
X0061:Fus UTSW 7 127985433 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGGTGCTTGTAATTGAACTCCGACC -3'
(R):5'- GGAACCCTTGGCAATTCTACCCAC -3'

Sequencing Primer
(F):5'- gactggggcagaatcagg -3'
(R):5'- CTTGCCAACTTTGAGCATAGGAG -3'
Posted On2013-07-11