Incidental Mutation 'R0588:Crtc1'
List |< first << previous [record 9 of 25] next >> last >|
ID55839
Institutional Source Beutler Lab
Gene Symbol Crtc1
Ensembl Gene ENSMUSG00000003575
Gene NameCREB regulated transcription coactivator 1
SynonymsMect1, TORC1
MMRRC Submission 038778-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.511) question?
Stock #R0588 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70382355-70439579 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70439549 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 4 (S4P)
Ref Sequence ENSEMBL: ENSMUSP00000075916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076615]
Predicted Effect probably damaging
Transcript: ENSMUST00000076615
AA Change: S4P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075916
Gene: ENSMUSG00000003575
AA Change: S4P

DomainStartEndE-ValueType
Pfam:TORC_N 6 66 1.1e-26 PFAM
Pfam:TORC_M 148 289 4.8e-64 PFAM
low complexity region 359 394 N/A INTRINSIC
Pfam:TORC_C 555 630 9.2e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142769
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (25/25)
MGI Phenotype PHENOTYPE: Mice homozygous for an inactivating mutation in this gene are hyperphagic, obese and infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,603,061 K1299* probably null Het
Adamts2 G T 11: 50,776,664 W476C probably damaging Het
Ankrd13c T C 3: 158,005,817 F525L probably damaging Het
Arg1 T C 10: 24,920,624 S102G probably damaging Het
Atp2a3 A T 11: 72,973,024 D192V possibly damaging Het
Cabin1 T C 10: 75,745,337 E385G possibly damaging Het
Cacna1h A T 17: 25,387,564 D1020E probably damaging Het
Calcb C T 7: 114,720,126 H48Y probably benign Het
Dcaf6 A G 1: 165,420,223 I147T possibly damaging Het
Ears2 T C 7: 122,044,291 probably benign Het
Fas T C 19: 34,327,140 V267A probably damaging Het
Fus T C 7: 127,985,574 L84P probably damaging Het
Fyb T C 15: 6,580,459 V171A probably benign Het
Gdap2 T A 3: 100,170,001 M1K probably null Het
Gprc5b T A 7: 118,983,995 Q217L probably benign Het
Lrrc69 A G 4: 14,704,001 I273T possibly damaging Het
Map4k4 C A 1: 40,004,864 Q556K possibly damaging Het
Npy6r T A 18: 44,275,821 V103E possibly damaging Het
Olfr1449 A G 19: 12,934,747 Y3C probably benign Het
Shisa9 A G 16: 12,267,774 T416A probably damaging Het
Slc26a9 C A 1: 131,754,011 probably benign Het
Sostdc1 G T 12: 36,317,021 probably benign Het
St18 T A 1: 6,817,738 F510L probably damaging Het
Zdhhc7 A G 8: 120,083,367 probably benign Het
Other mutations in Crtc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Crtc1 APN 8 70439522 missense probably benign 0.01
IGL01361:Crtc1 APN 8 70387603 missense probably damaging 1.00
IGL02883:Crtc1 APN 8 70406125 missense probably benign 0.28
R0049:Crtc1 UTSW 8 70391859 critical splice donor site probably null
R0196:Crtc1 UTSW 8 70386221 missense probably damaging 1.00
R0514:Crtc1 UTSW 8 70402429 critical splice donor site probably null
R0744:Crtc1 UTSW 8 70393013 missense probably benign 0.00
R0833:Crtc1 UTSW 8 70393013 missense probably benign 0.00
R0836:Crtc1 UTSW 8 70393013 missense probably benign 0.00
R0905:Crtc1 UTSW 8 70391255 missense probably damaging 1.00
R1016:Crtc1 UTSW 8 70392119 nonsense probably null
R1300:Crtc1 UTSW 8 70387539 critical splice donor site probably null
R1533:Crtc1 UTSW 8 70398299 missense probably damaging 1.00
R1843:Crtc1 UTSW 8 70388152 missense probably benign 0.00
R2393:Crtc1 UTSW 8 70388158 missense probably benign
R4867:Crtc1 UTSW 8 70402514 missense probably damaging 1.00
R5339:Crtc1 UTSW 8 70397733 splice site probably benign
R6062:Crtc1 UTSW 8 70406189 missense probably damaging 1.00
R6342:Crtc1 UTSW 8 70439557 start codon destroyed probably null 0.95
R6912:Crtc1 UTSW 8 70398311 missense probably damaging 1.00
R7910:Crtc1 UTSW 8 70387601 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGGGACCACCTGTCAAGTCCAAAG -3'
(R):5'- TGGAGTCCAGTGAATGCAGGCATC -3'

Sequencing Primer
(F):5'- GTCAAGTCCAAAGAGCAATCTCG -3'
(R):5'- CAGTGAATGCAGGCATCAGTTC -3'
Posted On2013-07-11